Table 4

Primers for FKBP12 and FKBP12.6 amplification of coding exons and flanking region sequences.

Gene

Exon

Primer

Amplicon


FKBP12

1F

5'- TCTCGGGGCTTCTGGGCTTC -3'

269


1R

5'- GCGCCACTACTCACCGTCTC -3'


2F

5'- CATGCCCGTCTCTGTCTCCTCA -3'

242


2R

5'- AAGCCCCAGGCTGCCCCTGA -3'


3F

5'- TGCTGCTGGTTTCTGACTTGT -3'

299


3R

5'- TGGCATGAGGGTGAGACTTTTC -3'


4F

5'- TTTCTTACAGAGACAGTTGGGG -3'

253


4R

5'- GCCCTTCAGTATTCCATTTCCT -3'


FKBP12.6

1F

5'- GAATGGATGGATGGAGGATG -3'

527


1R

5'- TCCTAGACCCCCAAGAATCC -3'


2F

5'-CCAGAGAGGTGACGTGA-3'

390


2R

5'-TAGACTGGCTGGGAGGA-3'


3F

5'-GGGAGTTTACTCATGACCA-3'

368


3R

5'-CAGGGACACAAAAGAGGTA-3'


4F

5'-CAGTCACATCTCTGCTGA-3'

510


4R

5'-CGCATGAACACTGACGAA-3'


Biagi et al. Journal of Negative Results in BioMedicine 2012 11:4   doi:10.1186/1477-5751-11-4

Open Data