JNRBM

unofficial impact factor 1.10

Open Access Highly Access Research

Genetic polymorphisms and susceptibility to lung disease

Pauline L Lee*, Carol West, Karen Crain and Lei Wang

Author Affiliations

The Scripps Research Institute, Department of Molecular and Experimental Medicine, 10550 North Torrey Pines Road, La Jolla, 92037, USA

For all author emails, please log on.

Journal of Negative Results in BioMedicine 2006, 5:5 doi:10.1186/1477-5751-5-5


The electronic version of this article is the complete one and can be found online at: http://www.jnrbm.com/content/5/1/5


Received:3 March 2006
Accepted:11 April 2006
Published:11 April 2006

© 2006 Lee et al; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Susceptibility to infection by bacterium such as Bacillus anthracis has a genetic basis in mice and may also have a genetic basis in humans. In the limited human cases of inhalation anthrax, studies suggest that not all individuals exposed to anthrax spores were infected, but rather, individuals with underlying lung disease, particularly asthma, sarcoidosis and tuberculosis, might be more susceptible. In this study, we determined if polymorphisms in genes important in innate immunity are associated with increased susceptibility to infectious and non-infectious lung diseases, particularly tuberculosis and sarcoidosis, respectively, and therefore might be a risk factor for inhalation anthrax. Examination of 45 non-synonymous polymorphisms in ten genes: p47phox (NCF1), p67phox (NCF2), p40phox (NCF4), p22phox (CYBA), gp91phox (CYBB), DUOX1, DUOX2, TLR2, TLR9 and alpha 1-antitrypsin (AAT) in a cohort of 95 lung disease individuals and 95 control individuals did not show an association of these polymorphisms with increased susceptibility to lung disease.

Introduction

Since October 2001, when Bacillus anthracis was released in the United States as an act of bioterrorism, there has been a greater interest in determining if there are risk factors for inhalation anthrax infection. Exposure to Bacillus anthracis spores does not cause infection in all exposed individuals [1]. Epidemiologic studies of individuals infected by inhalation anthrax have suggested that a weakened immune system might increase susceptibility to infection by Bacillus anthracis [2]. Some of the infected individuals had a history of chronic pulmonary disease, including asthma, sarcoidosis, and tuberculosis [2-4]. Studies in mice have demonstrated a genetic basis for anthrax sensitivity [5,6]. For example, macrophages from C3H mice are 100,000 times more sensitive to the Bacillus anthracis toxin than macrophages from A/J mice [6]. The current study examines whether there are genetic polymorphisms in humans associated with increased susceptibility to lung disease. Identification of genes associated with an increased risk of lung disease might identify individuals who might also be of increased susceptibility to inhalation anthrax infection.

The NAD(P)H oxidases (NOX) are a family of enzymes that are essential in host defense against microbial infection, as reviewed by Quinn and Gauss [7]. The central enzyme of the NAD(P)H oxidase is a flavin and heme-containing protein, the most well known being the phagocytic gp91phox (CYBB, NOX2) protein. gp91phox, and a number of related proteins including DUOX1 and DUOX2, are transmembrane proteins which transport electrons and generate reactive oxygen species (ROS) at the expense of NADH or NADPH. The activity of the oxidases are highly regulated by accessory proteins, including p22phox (CYBA), p47phox (NOXO1, NCF1), p67phox (NOXA2, NCF2), and p40phox (NCF4). Chronic Granulomatous Disease (CGD), associated with severe, recurrent, and chronic non-specific bacterial and fungal infections, is most commonly caused by mutations in p47phox, gp91phox, p67phox, and p22phox that severely compromise the respiratory burst activity of neutrophils.

Görlach et al were the first to identify the presence of at least one pseudogene copy of the p47phox (NCF1) gene on chromosome 7q11.23 [8]. By construction of a detailed physical map of this region Hockenhull et al determined that there were one normal wildtype copy and two pseudogene copies of NCF1 per chromosome [9]. Heyworth et al elegantly demonstrated that in some individuals, one of the pseudogene copies of NCF1, possibly by recombination or gene conversion, has reverted to the normal wildtype GTGT sequence (i.e. pseudowildtype) [10]. Thus, individuals with this low frequency polymorphism of NCF1, have 2 "wildtype" copies and one pseudogene copy per chromosome [10]. Therefore, individuals (with 2 chromosomes) can have a NCF1 pseudogene: wt copy ratio of either 2:1, 1:1 or 1:2. Although two groups have examined the association of the minor 1:1 and 1:2 alleles with inflammatory bowel disease, the conclusions were in conflict primarily due to differences in allele frequencies of the control population and sample size [11,12]. Other polymorphisms in p47phox, p67phox and gp91phox, have not been shown to be associated with human disease other than CGD. Recently p47phox has been shown by positional cloning to regulate the severity of arthritis in rats [13]. The H72Y polymorphisms in p22phox (CYBA), associated with reduced respiratory burst in isolated human neutrophils [14], but has yet to be shown to be clearly associated with a disease phenotype [15-17]. DUOX1 and DUOX2, which are expressed in lung epithelium, regulates H2O2 [18-20] and acid [21] production in the airway but have not been shown to be associated with lung disease. Mutations in DUOX2 have been shown to be associated with mild hypothyroidism [22-24].

TLR2 is the receptor for peptidoglycans, lipoteichoic acid, lipoarabinomannan, mycolylarabinogalactan, and zymosan. Anthrax infection is thought to be partially mediated through the TLR2 pathway since TLR2 deficient mice are resistant to infection by the Sterne strain of Bacillus anthracis and HEK293 cells expressing TLR2, but not TLR4, are able to signal in response to exposure to heat-inactivated Bacillus anthracis [25]. Inactivation and killing of the tuberculosis mycobacterium is also mediated through TLR2 since macrophages from Tlr2-deficient mice or human macrophages blocked by anti-TLR2 antibodies failed to kill the bacteria [26]. Tlr9 and Tlr2 double knockout mice display a more pronounced susceptibility to infection by tuberculosis than single gene knockout mice [27]. The TLR2 polymorphism R753Q [28] and the R677W polymorphism in humans [29-31] have been shown to be associated with increase risk for tuberculosis infection. The R753Q polymorphism was not associated with a generalized increased risk of infection, e.g. individuals with R753Q were less responsive to infection by Borrelia burgdorferi, which causes Lyme Disease [32] and R753Q was not associated with increased susceptibility to Staphylococcus aureus infection [33].

Alpha-1-anti-trypsin (AAT) deficiency has been associated with increased susceptibility to lung disease, particularly emphysema [34,35]. Although more than 70 variants have been described, only a few are associated with reduced AAT protein expression and/or reduced activity [35]. Several studies have suggested that simple heterozygosity for mutant alleles of AAT may predispose individuals to chronic obstructive lung disease [35-37]. The Z allele (E366K), which occurs at an allele frequency of 0.01–0.02 in people of European origin, is the most common allele associated with an increased risk of environmentally induced emphysema [34,38-40]. Homozygous individuals of the AAT S allele (E288V) are not at risk for emphysema but compound heterozygotes of the Z and S allele or a null allele are of increased risk [39,41]. Carriers of the AAT S and Z alleles are over-represented in individuals with lung cancer [42]

In this study, we attempted to determine whether normal nonsynonymous genetic variations identified by the Genbank SNP database or previously described in the literature to be present in the normal population in the genes for p47phox (NCF1), p67phox (NCF2), p40phox (NCF4), gp91phox (CYBB), p22phox (CYBA), DUOX1, DUOX2, TLR2, TLR9 and alpha-1 anti-trypsin (AAT) are associated with an increased susceptibility to tuberculosis, sarcoidosis, recurrent pneumonia, and atypical mycobacterial infection.

Materials and methods

Study participants

Anonymized blood samples from control individuals of European, non-Hispanic origin (n = 95) were obtained from Kaiser Permanente [43] or from The Scripps Research Institute GCRC blood drawing program. From a group of 31,247 participants in a Kaiser Permanente study of European, non-Hispanic origin [43], all individuals that had a documented medical history with hospitalization for lung diseases: atypical mycobacterial infection (n = 1), repeated episodes of pneumonia (n = 5), sarcoidosis (n = 46), and tuberculosis (n = 43), were selected and will be referred to as the lung disease group (n = 95). The participants in the Kaiser Permanente study were members of Kaiser Permanente attending a Health Appraisal Clinic and were not selected for underlying acute or chronic disease. All human samples were obtained with written consent. Approvals for the protocols involving the use of human individuals were obtained from the institutional review boards of The Scripps Research Institute and Kaiser Permanente.

p47phox/NCF1 pseudogene: wildtype ratio

Amplification of the region of p47phox exon 2 with the wildtype GTGT sequence and the pseudogene delGT sequence were amplified using primers p47phox/NCF1 Ex2F GCTTCCTCCAGTGGGTAGTGGGATC and p47phox/NCF 161R GGAACTCGTAGATCTCGGTGAAGC and 32P-labeled p47phox/NCF1 Ex2F primer under standard PCR conditions for 25 cycles. The 32P-labeled amplified DNA products were separated on a 10% acrylamide/urea/TBE sequencing gel. Autoradiography was used to visualize the wildtype and pseudogene amplified products, which differ by 2 nucleotides in length.

Genotyping of single nucleotide polymorphisms (SNPs) by allele specific oligomer hybridization (ASOH)

For the genes of this study, non-synonymous SNPs identified in Genbank's SNP database and/or non-synonynous SNPs associated with lung disease were investigated. Amplification of DNA regions encompassing the SNPs were amplified using the primers listed in Table 1. ASOH was performed using standard hybridization conditions [44] using 32P radiolabeled probes and washing temperatures described in Table 1. Genotyping was determined following visualization of the hybridized probe by autoradiography.

Table 1. Primer List. List of primers used for DNA amplification and ASOH.

Statistics

The Fisher's Exact test was performed with GraphPad InStat using the raw data entered into a 2 × 2 contingency table. Power calculations were performed to give the probability of finding the differences between the gene frequencies as statistically significant, given the sample size.

Results

We examined 95 individuals of European, non-Hispanic origin with documented medical history with hospitalization for lung disease (46 with sarcoidosis, 43 with tuberculosis, five with recurrent pneumonia, and one with atypical mycobacterial infection) and 95 control individuals of European, non-Hispanic origin for differences in allele frequencies in genes involved in innate immunity.

P47phox/(NCF1)

Examination of the pseudogene: wt copy ratio of control versus lung disease individuals demonstrated no statistically significant difference in the frequencies of the pseudogene: wt ratios in the lung disease group as compared to the control group (Table 2).

Table 2. Pseudogene versus gene ratio. p47phox/NCF1 pseudogene: wt gene ratio in lung disease and control individuals. The data are presented as number of individuals with the indicated pseudogene:wt ratio and the number within parentheses indicates the calculated frequency.

p67phox (NCF2), p40phox (NCF4), p22phox (CYBA), gp91phox (CYBB), DUOX1, DUOX2

SNPs in the p67phox (NCF2), p40phox (NCF4), p22phox (CYBA) and gp91phox (CYBB), DUOX1 and DUOX2 genes were examined. Some SNPs did not occur at a high enough frequency to be detected in our samples. None of the allele frequencies differed significantly between the lung disease and the control groups (Table 3).

Table 3. Summary of SNP Analyses. SNP analyses of candidate genes in lung disease versus control groups. Numbering of SNPs start from the ATG initiator methionine of the cDNA. Data are presented as number of alleles identified divided by total number of alleles examined. Numbers within parentheses are the calculated allele frequencies. Power calculations were performed using number of subjects.

TLR2, TLR9, AAT

TLR2, TLR9, and AAT genes were examined. Again, many SNPs did not occur at high enough frequency to be observed. Most of the allele frequencies did not differ between the lung disease and control groups. The TLR2 polymorphism R753Q, associated with tuberculosis, was not shown to be different between the control or lung disease group. The TLR2 R677W polymorphism, also associated with tuberculosis, was not observed in either group. The R863Q SNP in TLR9 was absent from the lung disease group indicating that this polymorphism was not associated with increased lung disease. The AAT S (Glu288Val) and Z (E366K) alleles, associated with chronic obstructive lung disease, were examined and there was no difference in allele frequencies between the control and lung disease groups (Table 3).

Discussion

Since only a subset of individuals exposed to Bacillus anthracis spores develop pulmonary disease, the most life-threatening form of anthrax infection, it would be important to identify factors that lead to susceptibility to this type of infection. This might make it possible to identify those individuals who are at greatest risk and to provide them with the most aggressive treatment at the outset of infection. The ability to thus triage individuals in the case of a bioterrorism attack would be valuable. Moreover, understanding genetic susceptibility could lead to better management of individuals with pulmonary anthrax infection.

The genetic influences on resistance to infection are very strong. Indeed, genetic influences on resistance to infection appear to be greater than genetic influences on cancer or cardiovascular disease [45]. In the past few decades a considerable number of polymorphisms have been shown to cause infectious disease susceptibility in mice [6] and in humans [28,31,46]. Because infections caused by Bacillus anthracis are rare it was impossible to examine candidate polymorphisms in patients who actually developed pulmonary anthrax. Instead, it was necessary to use surrogate infections such as unusual mycobacterial infections, recurrent pneumonia, and tuberculosis or examine lung diseases such as sarcoidosis, which has been reported in cases of inhalation anthrax, for this study. The "lung disease group" in this study represented all the individuals with documented hospitalization for lung disease from a collection of 31,247 individuals of European, non-Hispanic origin unselected for any particular acute or chronic health problem. Candidate genes were chosen on the basis of their role in immunity against chronic infection as well as their participation in the innate immune response. This is a reasonable approach, since defects in the immune system generally increases susceptibility not to a single organism, but rather to multiple organisms that share some features in the pathogenesis of the disease that they produce.

Our analyses of genes of the NAD(P)H oxidase, p47 (NCF1), p67phox (NCF2), p40phox (NCF4), p22phox (CYBA), and gp91phox (CYBB), as well as other genes involved in innate immunity such as DUOX1 and 2, TLR2, TLR9 and AAT demonstrated that there were no differences between the control and lung disease group comprised of primarily sarcoidosis and tuberculosis individuals. There may, of course, be many other polymorphisms that affect susceptibility to Bacillus anthracis. Although the genes that we chose seemed to be reasonable candidates; there are many additional genes encoding products that could be important in effecting the course of anthrax in humans. For example, it has been suggested that susceptibility to Bacillus anthracis might involve myD88 [25]. Furthermore, susceptibility to infection by tuberculosis may be altered by variations in the vitamin D receptor gene [47]. Similarly, sarcoidosis has been shown to be associated with particular alleles in BTNL2 [48,49], IL18 [50], and IFNa [51], and SLC11A1 [52].

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

Each author contributed substantially to the design, acquisition, and analysis of the data. PLL supervised the project and wrote the manuscript. Each author has read and approved the manuscript prior to submission.

Acknowledgements

This is manuscript number MEM18018. This work was supported by the CDC 5PO1 CI000095 and the Stein Endowment Fund. The authors would like to thank Dr. Jill Waalen for performing the power calculations and Drs. Ernest Beutler, Gary Bokoch, Bruce Beutler, Ulla Knaus, and Bruce Zuraw for their helpful discussions.

References

  1. Bales ME, Dannenberg AL, Brachman PS, Kaufmann AF, Klatsky PC, Ashford DA: Epidemiologic response to anthrax outbreaks: field investigations, 1950-2001.

    Emerg Infect Dis 2002, 8:1163-1174. PubMed Abstract OpenURL

  2. Brachman PS: Inhalation anthrax.

    Ann N Y Acad Sci 1980, 353:83-93. PubMed Abstract OpenURL

  3. Mayer TA, Bersoff-Matcha S, Murphy C, Earls J, Harper S, Pauze D, Nguyen M, Rosenthal J, Cerva DJ, Druckenbrod G, Hanfling D, Fatteh N, Napoli A, Nayyar A, Berman EL: Clinical presentation of inhalational anthrax following bioterrorism exposure: report of 2 surviving patients.

    JAMA 2001, 286:2549-2553. PubMed Abstract | Publisher Full Text OpenURL

  4. Borio L, Frank D, Mani V, Chiriboga C, Pollanen M, Ripple M, Ali S, DiAngelo C, Lee J, Arden J, Titus J, Fowler D, O'Toole T, Masur H, Bartlett J, Inglesby T: Death due to bioterrorism-related inhalational anthrax: report of 2 patients.

    JAMA 2001, 286:2554-2559. PubMed Abstract | Publisher Full Text OpenURL

  5. Shibaya M, Kubomichi M, Watanabe T: The genetic basis of host resistance to Bacillus anthracis in inbred mice.

    Vet Microbiol 1991, 26:309-312. PubMed Abstract | Publisher Full Text OpenURL

  6. Friedlander AM, Bhatnagar R, Leppla SH, Johnson L, Singh Y: Characterization of macrophage sensitivity and resistance to anthrax lethal toxin.

    Infect Immun 1993, 61:245-252. PubMed Abstract | PubMed Central Full Text OpenURL

  7. Quinn MT, Gauss KA: Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases.

    J Leukoc Biol 2004, 76:760-781. PubMed Abstract | Publisher Full Text OpenURL

  8. Gorlach A, Lee PL, Roesler J, Hopkins PJ, Christensen B, Green ED, Chanock SJ, Curnutte JT: A p47-phox pseudogene carries the most common mutation causing p47-phox- deficient chronic granulomatous disease.

    J Clin Invest 1997, 100:1907-1918. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  9. Hockenhull EL, Carette MJ, Metcalfe K, Donnai D, Read AP, Tassabehji M: A complete physical contig and partial transcript map of the Williams syndrome critical region.

    Genomics 1999, 58:138-145. PubMed Abstract | Publisher Full Text OpenURL

  10. Heyworth PG, Noack D, Cross AR: Identification of a novel NCF-1 (p47-phox) pseudogene not containing the signature GT deletion: significance for A47 degrees chronic granulomatous disease carrier detection.

    Blood 2002, 100:1845-1851. PubMed Abstract | Publisher Full Text OpenURL

  11. Suraweera N, Zampeli E, Rogers P, Atkin W, Forbes A, Harbord M, Silver A: NCF1 (p47phox) and ncf1 pseudogenes are not associated with inflammatory bowel disease.

    Inflamm Bowel Dis 2004, 10:758-762. PubMed Abstract | Publisher Full Text OpenURL

  12. Harbord M, Hankin A, Bloom S, Mitchison H: Association between p47phox pseudogenes and inflammatory bowel disease.

    Blood 2003, 101:3337. PubMed Abstract | Publisher Full Text OpenURL

  13. Olofsson P, Holmberg J, Tordsson J, Lu S, Akerstrom B, Holmdahl R: Positional identification of Ncf1 as a gene that regulates arthritis severity in rats.

    Nat Genet 2003, 33:25-32. PubMed Abstract | Publisher Full Text OpenURL

  14. Wyche KE, Wang SS, Griendling KK, Dikalov SI, Austin H, Rao S, Fink B, Harrison DG, Zafari AM: C242T CYBA polymorphism of the NADPH oxidase is associated with reduced respiratory burst in human neutrophils.

    Hypertension 2004, 43:1246-1251. PubMed Abstract | Publisher Full Text OpenURL

  15. Shimo-Nakanishi Y, Hasebe T, Suzuki A, Mochizuki H, Nomiyama T, Tanaka Y, Nagaoka I, Mizuno Y, Urabe T: Functional effects of NAD(P)H oxidase p22(phox) C242T mutation in human leukocytes and association with thrombotic cerebral infarction.

    Atherosclerosis 2004, 175:109-115. PubMed Abstract | Publisher Full Text OpenURL

  16. Mata-Balaguer T, de la HR, Ruiz-Rejon C, Ruiz-Rejon M, Garrido-Ramos MA, Ruiz-Rejon F: Angiotensin-converting enzyme and p22(phox) polymorphisms and the risk of coronary heart disease in a low-risk Spanish population.

    Int J Cardiol 2004, 95:145-151. PubMed Abstract | Publisher Full Text OpenURL

  17. Van Der Logt EM, Janssen CH, Van Hooijdonk Z, Roelofs HM, Wobbes T, Nagengast FM, Peters WH: No association between genetic polymorphisms in NAD(P)H oxidase p22phox and paraoxonase 1 and colorectal cancer risk.

    Anticancer Res 2005, 25:1465-1470. PubMed Abstract OpenURL

  18. Geiszt M, Witta J, Baffi J, Lekstrom K, Leto TL: Dual oxidases represent novel hydrogen peroxide sources supporting mucosal surface host defense.

    FASEB J 2003, 17:1502-1504. PubMed Abstract | Publisher Full Text OpenURL

  19. Forteza R, Salathe M, Miot F, Forteza R, Conner GE: Regulated hydrogen peroxide production by Duox in human airway epithelial cells.

    Am J Respir Cell Mol Biol 2005, 32:462-469. PubMed Abstract | Publisher Full Text OpenURL

  20. Ameziane-El-Hassani R, Morand S, Boucher JL, Frapart YM, Apostolou D, Agnandji D, Gnidehou S, Ohayon R, Noel-Hudson MS, Francon J, Lalaoui K, Virion A, Dupuy C: Dual oxidase-2 has an intrinsic Ca2+-dependent H2O2-generating activity.

    J Biol Chem 2005, 280:30046-30054. PubMed Abstract | Publisher Full Text OpenURL

  21. Schwarzer C, Machen TE, Illek B, Fischer H: NADPH oxidase-dependent acid production in airway epithelial cells.

    J Biol Chem 2004, 279:36454-36461. PubMed Abstract | Publisher Full Text OpenURL

  22. Moreno JC: Identification of novel genes involved in congenital hypothyroidism using serial analysis of gene expression.

    Horm Res 2003, 60 Suppl 3:96-102. PubMed Abstract | Publisher Full Text OpenURL

  23. Vigone MC, Fugazzola L, Zamproni I, Passoni A, Di Candia S, Chiumello G, Persani L, Weber G: Persistent mild hypothyroidism associated with novel sequence variants of the DUOX2 gene in two siblings.

    Hum Mutat 2005, 26:395. PubMed Abstract | Publisher Full Text OpenURL

  24. Varela V, Rivolta CM, Esperante SA, Gruneiro-Papendieck L, Chiesa A, Targovnik HM: Three Mutations (p.Q36H, p.G418fsX482, and g.IVS19-2A>C) in the Dual Oxidase 2 Gene Responsible for Congenital Goiter and Iodide Organification Defect.

    Clin Chem 2005. PubMed Abstract | Publisher Full Text OpenURL

  25. Hughes MA, Green CS, Lowchyj L, Lee GM, Grippe VK, Smith MFJ, Huang LY, Harvill ET, Merkel TJ: MyD88-dependent signaling contributes to protection following Bacillus anthracis spore challenge of mice: implications for Toll-like receptor signaling.

    Infect Immun 2005, 73:7535-7540. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  26. Thoma-Uszynski S, Stenger S, Takeuchi O, Ochoa MT, Engele M, Sieling PA, Barnes PF, Rollinghoff M, Bolcskei PL, Wagner M, Akira S, Norgard MV, Belisle JT, Godowski PJ, Bloom BR, Modlin RL: Induction of direct antimicrobial activity through mammalian toll-like receptors.

    Science 2001, 291:1544-1547. PubMed Abstract | Publisher Full Text OpenURL

  27. Bafica A, Scanga CA, Feng CG, Leifer C, Cheever A, Sher A: TLR9 regulates Th1 responses and cooperates with TLR2 in mediating optimal resistance to Mycobacterium tuberculosis.

    J Exp Med 2005, 202:1715-1724. PubMed Abstract | Publisher Full Text OpenURL

  28. Ogus AC, Yoldas B, Ozdemir T, Uguz A, Olcen S, Keser I, Coskun M, Cilli A, Yegin O: The Arg753GLn polymorphism of the human toll-like receptor 2 gene in tuberculosis disease.

    Eur Respir J 2004, 23:219-223. PubMed Abstract | Publisher Full Text OpenURL

  29. Texereau J, Chiche JD, Taylor W, Choukroun G, Comba B, Mira JP: The importance of Toll-like receptor 2 polymorphisms in severe infections.

    Clin Infect Dis 2005, 41 Suppl 7:S408-S415. PubMed Abstract | Publisher Full Text OpenURL

  30. Bochud PY, Hawn TR, Aderem A: Cutting edge: a Toll-like receptor 2 polymorphism that is associated with lepromatous leprosy is unable to mediate mycobacterial signaling.

    J Immunol 2003, 170:3451-3454. PubMed Abstract | Publisher Full Text OpenURL

  31. Ben Ali M, Barbouche MR, Bousnina S, Chabbou A, Dellagi K: Toll-like receptor 2 Arg677Trp polymorphism is associated with susceptibility to tuberculosis in Tunisian patients.

    Clin Diagn Lab Immunol 2004, 11:625-626. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  32. Schroder NW, Diterich I, Zinke A, Eckert J, Draing C, von BV, Hassler D, Priem S, Hahn K, Michelsen KS, Hartung T, Burmester GR, Gobel UB, Hermann C, Schumann RR: Heterozygous Arg753Gln polymorphism of human TLR-2 impairs immune activation by Borrelia burgdorferi and protects from late stage Lyme disease.

    J Immunol 2005, 175:2534-2540. PubMed Abstract | Publisher Full Text OpenURL

  33. Moore CE, Segal S, Berendt AR, Hill AV, Day NP: Lack of association between Toll-like receptor 2 polymorphisms and susceptibility to severe disease caused by Staphylococcus aureus.

    Clin Diagn Lab Immunol 2004, 11:1194-1197. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  34. Barnett TB, Gottovi D, Johnson AM: Protease inhibitors in chronic obstructive pulmonary disease.

    Am Rev Respir Dis 1975, 111:587-593. PubMed Abstract OpenURL

  35. Lieberman J: The multiple causes of alpha1-antitrypsin deficiency.

    Pathol Biol (Paris) 1975, 23:517-520. PubMed Abstract OpenURL

  36. Tarkoff MP, Kueppers F, Miller WF: Pulmonary emphysema and alpha 1-antitrypsin deficiency.

    Am J Med 1968, 45:220-228. PubMed Abstract | Publisher Full Text OpenURL

  37. Kueppers F, Fallat R, Larson RK: Obstructive lung disease and alpha-1-antitrypsin deficiency gene heterozygosity.

    Science 1969, 165:899-901. PubMed Abstract OpenURL

  38. Sandford AJ, Weir TD, Spinelli JJ, Pare PD: Z and S mutations of the alpha1-antitrypsin gene and the risk of chronic obstructive pulmonary disease.

    Am J Respir Cell Mol Biol 1999, 20:287-291. PubMed Abstract | Publisher Full Text OpenURL

  39. Larsson C, Dirksen H, Sundstrom G, Eriksson S: Lung function studies in asymptomatic individuals with moderately (Pi SZ) and severely (Pi Z) reduced levels of alpha1-antitrypsin.

    Scand J Respir Dis 1976, 57:267-280. PubMed Abstract OpenURL

  40. Cox DW, Hoeppner VH, Levison H: Protease inhibitors in patients with chronic obstructive pulmonary disease: the alpha-antitrypsin heterozygote controversy.

    Am Rev Respir Dis 1976, 113:601-606. PubMed Abstract OpenURL

  41. Dahl M, Hersh CP, Ly NP, Berkey CS, Silverman EK, Nordestgaard BG: The protease inhibitor PI*S allele and COPD: a meta-analysis.

    Eur Respir J 2005, 26:67-76. PubMed Abstract | Publisher Full Text OpenURL

  42. Yang P, Wentzlaff KA, Katzmann JA, Marks RS, Allen MS, Lesnick TG, Lindor NM, Myers JL, Wiegert E, Midthun DE, Thibodeau SN, Krowka MJ: Alpha1-antitrypsin deficiency allele carriers among lung cancer patients.

    Cancer Epidemiol Biomarkers Prev 1999, 8:461-465. PubMed Abstract | Publisher Full Text OpenURL

  43. Beutler E, Felitti V, Gelbart T, Ho N: The effect of HFE genotypes in patients attending a health appraisal clinic. [http://c:\b#\pdf\b1166.pdf] webcite

    Ann Intern Med 2000, 133:329-337. PubMed Abstract | Publisher Full Text OpenURL

  44. Lee PL, Gelbart T, West C, Halloran C, Felitti V, Beutler E: A study of genes that may modulate the expression of hereditary hemochromatosis: Transferrin receptor-1, ferroportin, ceruloplasmin, ferritin light and heavy chains, iron regulatory proteins (IRP)-1 and -2, and hepcidin. [http://c:\b#\pdf\b1217.pdf] webcite

    Blood Cells Mol Dis 2001, 27:783-802. PubMed Abstract | Publisher Full Text OpenURL

  45. Sorensen TI, Nielsen GG, Andersen PK, Teasdale TW: Genetic and environmental influences on premature death in adult adoptees.

    N Engl J Med 1988, 318:727-732. PubMed Abstract OpenURL

  46. Lell B, May J, Schmidt-Ott RJ, Lehman LG, Luckner D, Greve B, Matousek P, Schmid D, Herbich K, Mockenhaupt FP, Meyer CG, Bienzle U, Kremsner PG: The role of red blood cell polymorphisms in resistance and susceptibility to malaria.

    Clinical Infectious Diseases 1999, 28:794-799. PubMed Abstract OpenURL

  47. Lewis SJ, Baker I, Davey SG: Meta-analysis of vitamin D receptor polymorphisms and pulmonary tuberculosis risk.

    Int J Tuberc Lung Dis 2005, 9:1174-1177. PubMed Abstract OpenURL

  48. Rybicki BA, Walewski JL, Maliarik MJ, Kian H, Iannuzzi MC: The BTNL2 gene and sarcoidosis susceptibility in African Americans and Whites.

    Am J Hum Genet 2005, 77:491-499. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  49. Valentonyte R, Hampe J, Huse K, Rosenstiel P, Albrecht M, Stenzel A, Nagy M, Gaede KI, Franke A, Haesler R, Koch A, Lengauer T, Seegert D, Reiling N, Ehlers S, Schwinger E, Platzer M, Krawczak M, Muller-Quernheim J, Schurmann M, Schreiber S: Sarcoidosis is associated with a truncating splice site mutation in BTNL2.

    Nat Genet 2005, 37:357-364. PubMed Abstract | Publisher Full Text OpenURL

  50. Takada T, Suzuki E, Morohashi K, Gejyo F: Association of single nucleotide polymorphisms in the IL-18 gene with sarcoidosis in a Japanese population.

    Tissue Antigens 2002, 60:36-42. PubMed Abstract | Publisher Full Text OpenURL

  51. Akahoshi M, Ishihara M, Remus N, Uno K, Miyake K, Hirota T, Nakashima K, Matsuda A, Kanda M, Enomoto T, Ohno S, Nakashima H, Casanova JL, Hopkin JM, Tamari M, Mao XQ, Shirakawa T: Association between IFNA genotype and the risk of sarcoidosis.

    Hum Genet 2004, 114:503-509. PubMed Abstract | Publisher Full Text OpenURL

  52. Dubaniewicz A, Jamieson SE, Dubaniewicz-Wybieralska M, Fakiola M, Nancy ME, Blackwell JM: Association between SLC11A1 (formerly NRAMP1) and the risk of sarcoidosis in Poland.

    Eur J Hum Genet 2005, 13:829-834. PubMed Abstract | Publisher Full Text OpenURL