<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1477-5751-5-5</ui>
   <ji>1477-5751</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Genetic polymorphisms and susceptibility to lung disease</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Lee</snm>
               <mi>L</mi>
               <fnm>Pauline</fnm>
               <insr iid="I1"/>
               <email>plee@scripps.edu</email>
            </au>
            <au id="A2">
               <snm>West</snm>
               <fnm>Carol</fnm>
               <insr iid="I1"/>
               <insr iid="I1"/>
               <email>cwest@scripps.edu</email>
            </au>
            <au id="A3">
               <snm>Crain</snm>
               <fnm>Karen</fnm>
               <insr iid="I1"/>
               <insr iid="I1"/>
               <email>kcrain@scripps.edu</email>
            </au>
            <au id="A4">
               <snm>Wang</snm>
               <fnm>Lei</fnm>
               <insr iid="I1"/>
               <insr iid="I1"/>
               <email>leiw@scripps.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>The Scripps Research Institute, Department of Molecular and Experimental Medicine, 10550 North Torrey Pines Road, La Jolla, 92037, USA</p>
            </ins>
         </insg>
         <source>Journal of Negative Results in BioMedicine</source>
         <issn>1477-5751</issn>
         <pubdate>2006</pubdate>
         <volume>5</volume>
         <issue>1</issue>
         <fpage>5</fpage>
         <url>http://www.jnrbm.com/content/5/1/5</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16608528</pubid>
               <pubid idtype="doi">10.1186/1477-5751-5-5</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>03</day>
               <month>3</month>
               <year>2006</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>11</day>
               <month>4</month>
               <year>2006</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>11</day>
               <month>4</month>
               <year>2006</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2006</year>
         <collab>Lee et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <p>Susceptibility to infection by bacterium such as <it>Bacillus anthracis </it>has a genetic basis in mice and may also have a genetic basis in humans. In the limited human cases of inhalation anthrax, studies suggest that not all individuals exposed to anthrax spores were infected, but rather, individuals with underlying lung disease, particularly asthma, sarcoidosis and tuberculosis, might be more susceptible. In this study, we determined if polymorphisms in genes important in innate immunity are associated with increased susceptibility to infectious and non-infectious lung diseases, particularly tuberculosis and sarcoidosis, respectively, and therefore might be a risk factor for inhalation anthrax. Examination of 45 non-synonymous polymorphisms in ten genes: <it>p47phox </it>(<it>NCF1</it>), <it>p67phox </it>(<it>NCF2</it>), <it>p40phox </it>(<it>NCF4</it>), <it>p22phox </it>(<it>CYBA</it>), <it>gp91phox </it>(<it>CYBB</it>), <it>DUOX1</it>, <it>DUOX2</it>, <it>TLR2</it>, <it>TLR9 </it>and alpha 1-antitrypsin (<it>AAT</it>) in a cohort of 95 lung disease individuals and 95 control individuals did not show an association of these polymorphisms with increased susceptibility to lung disease.</p>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="refman"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Introduction</p>
         </st>
         <p>Since October 2001, when <it>Bacillus anthracis </it>was released in the United States as an act of bioterrorism, there has been a greater interest in determining if there are risk factors for inhalation anthrax infection. Exposure to <it>Bacillus anthracis </it>spores does not cause infection in all exposed individuals <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Epidemiologic studies of individuals infected by inhalation anthrax have suggested that a weakened immune system might increase susceptibility to infection by <it>Bacillus anthracis </it><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Some of the infected individuals had a history of chronic pulmonary disease, including asthma, sarcoidosis, and tuberculosis <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. Studies in mice have demonstrated a genetic basis for anthrax sensitivity <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. For example, macrophages from C3H mice are 100,000 times more sensitive to the <it>Bacillus anthracis </it>toxin than macrophages from A/J mice <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. The current study examines whether there are genetic polymorphisms in humans associated with increased susceptibility to lung disease. Identification of genes associated with an increased risk of lung disease might identify individuals who might also be of increased susceptibility to inhalation anthrax infection.</p>
         <p>The <b>N</b>AD(P)H <b>ox</b>idases (NOX) are a family of enzymes that are essential in host defense against microbial infection, as reviewed by Quinn and Gauss <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. The central enzyme of the NAD(P)H oxidase is a flavin and heme-containing protein, the most well known being the phagocytic gp91phox (CYBB, NOX2) protein. gp91phox, and a number of related proteins including DUOX1 and DUOX2, are transmembrane proteins which transport electrons and generate reactive oxygen species (ROS) at the expense of NADH or NADPH. The activity of the oxidases are highly regulated by accessory proteins, including p22phox (CYBA), p47phox (NOXO1, NCF1), p67phox (NOXA2, NCF2), and p40phox (NCF4). Chronic Granulomatous Disease (CGD), associated with severe, recurrent, and chronic non-specific bacterial and fungal infections, is most commonly caused by mutations in <it>p47phox</it>, <it>gp91phox</it>, <it>p67phox</it>, and <it>p22phox </it>that severely compromise the respiratory burst activity of neutrophils.</p>
         <p>G&#246;rlach et al were the first to identify the presence of at least one pseudogene copy of the <it>p47phox </it>(<it>NCF1</it>) gene on chromosome 7q11.23 <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. By construction of a detailed physical map of this region Hockenhull et al determined that there were one normal wildtype copy and two pseudogene copies of <it>NCF1 </it>per chromosome <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Heyworth et al elegantly demonstrated that in some individuals, one of the pseudogene copies of <it>NCF1</it>, possibly by recombination or gene conversion, has reverted to the normal wildtype GTGT sequence (i.e. pseudowildtype) <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. Thus, individuals with this low frequency polymorphism of <it>NCF1</it>, have 2 "wildtype" copies and one pseudogene copy per chromosome <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. Therefore, individuals (with 2 chromosomes) can have a <it>NCF1 </it>pseudogene: wt copy ratio of either 2:1, 1:1 or 1:2. Although two groups have examined the association of the minor 1:1 and 1:2 alleles with inflammatory bowel disease, the conclusions were in conflict primarily due to differences in allele frequencies of the control population and sample size <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. Other polymorphisms in <it>p47phox</it>, <it>p67phox </it>and <it>gp91phox</it>, have not been shown to be associated with human disease other than CGD. Recently <it>p47phox </it>has been shown by positional cloning to regulate the severity of arthritis in rats <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. The H72Y polymorphisms in <it>p22phox </it>(<it>CYBA</it>), associated with reduced respiratory burst in isolated human neutrophils <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, but has yet to be shown to be clearly associated with a disease phenotype <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>. DUOX1 and DUOX2, which are expressed in lung epithelium, regulates H<sub>2</sub>O<sub>2 </sub><abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp> and acid <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> production in the airway but have not been shown to be associated with lung disease. Mutations in <it>DUOX2 </it>have been shown to be associated with mild hypothyroidism <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>.</p>
         <p>TLR2 is the receptor for peptidoglycans, lipoteichoic acid, lipoarabinomannan, mycolylarabinogalactan, and zymosan. Anthrax infection is thought to be partially mediated through the TLR2 pathway since TLR2 deficient mice are resistant to infection by the Sterne strain of <it>Bacillus anthracis </it>and HEK293 cells expressing TLR2, but not TLR4, are able to signal in response to exposure to heat-inactivated <it>Bacillus anthracis </it><abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Inactivation and killing of the tuberculosis mycobacterium is also mediated through TLR2 since macrophages from Tlr2-deficient mice or human macrophages blocked by anti-TLR2 antibodies failed to kill the bacteria <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Tlr9 and Tlr2 double knockout mice display a more pronounced susceptibility to infection by tuberculosis than single gene knockout mice <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. The <it>TLR2 </it>polymorphism R753Q <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> and the R677W polymorphism in humans <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr></abbrgrp> have been shown to be associated with increase risk for tuberculosis infection. The R753Q polymorphism was not associated with a generalized increased risk of infection, e.g. individuals with R753Q were less responsive to infection by <it>Borrelia burgdorferi</it>, which causes Lyme Disease <abbrgrp><abbr bid="B32">32</abbr></abbrgrp> and R753Q was not associated with increased susceptibility to <it>Staphylococcus aureus </it>infection <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>.</p>
         <p>Alpha-1-anti-trypsin (AAT) deficiency has been associated with increased susceptibility to lung disease, particularly emphysema <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. Although more than 70 variants have been described, only a few are associated with reduced AAT protein expression and/or reduced activity <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. Several studies have suggested that simple heterozygosity for mutant alleles of <it>AAT </it>may predispose individuals to chronic obstructive lung disease <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr></abbrgrp>. The Z allele (E366K), which occurs at an allele frequency of 0.01&#8211;0.02 in people of European origin, is the most common allele associated with an increased risk of environmentally induced emphysema <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>. Homozygous individuals of the <it>AAT </it>S allele (E288V) are not at risk for emphysema but compound heterozygotes of the Z and S allele or a null allele are of increased risk <abbrgrp><abbr bid="B39">39</abbr><abbr bid="B41">41</abbr></abbrgrp>. Carriers of the AAT S and Z alleles are over-represented in individuals with lung cancer <abbrgrp><abbr bid="B42">42</abbr></abbrgrp></p>
         <p>In this study, we attempted to determine whether normal nonsynonymous genetic variations identified by the Genbank SNP database or previously described in the literature to be present in the normal population in the genes for <it>p47phox </it>(<it>NCF1</it>), <it>p67phox </it>(<it>NCF2</it>), <it>p40phox </it>(<it>NCF4</it>), <it>gp91phox </it>(<it>CYBB</it>), <it>p22phox </it>(<it>CYBA</it>), <it>DUOX1</it>, <it>DUOX2</it>, <it>TLR2</it>, <it>TLR9 </it>and alpha-1 anti-trypsin (<it>AAT</it>) are associated with an increased susceptibility to tuberculosis, sarcoidosis, recurrent pneumonia, and atypical mycobacterial infection.</p>
      </sec>
      <sec>
         <st>
            <p>Materials and methods</p>
         </st>
         <sec>
            <st>
               <p>Study participants</p>
            </st>
            <p>Anonymized blood samples from control individuals of European, non-Hispanic origin (n = 95) were obtained from Kaiser Permanente <abbrgrp><abbr bid="B43">43</abbr></abbrgrp> or from The Scripps Research Institute GCRC blood drawing program. From a group of 31,247 participants in a Kaiser Permanente study of European, non-Hispanic origin <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>, all individuals that had a documented medical history with hospitalization for lung diseases: atypical mycobacterial infection (n = 1), repeated episodes of pneumonia (n = 5), sarcoidosis (n = 46), and tuberculosis (n = 43), were selected and will be referred to as the lung disease group (n = 95). The participants in the Kaiser Permanente study were members of Kaiser Permanente attending a Health Appraisal Clinic and were not selected for underlying acute or chronic disease. All human samples were obtained with written consent. Approvals for the protocols involving the use of human individuals were obtained from the institutional review boards of The Scripps Research Institute and Kaiser Permanente.</p>
         </sec>
         <sec>
            <st>
               <p>p47phox/NCF1 pseudogene: wildtype ratio</p>
            </st>
            <p>Amplification of the region of p47phox exon 2 with the wildtype GTGT sequence and the pseudogene delGT sequence were amplified using primers p47phox/NCF1 Ex2F GCTTCCTCCAGTGGGTAGTGGGATC and p47phox/NCF 161R GGAACTCGTAGATCTCGGTGAAGC and <sup>32</sup>P-labeled p47phox/NCF1 Ex2F primer under standard PCR conditions for 25 cycles. The <sup>32</sup>P-labeled amplified DNA products were separated on a 10% acrylamide/urea/TBE sequencing gel. Autoradiography was used to visualize the wildtype and pseudogene amplified products, which differ by 2 nucleotides in length.</p>
         </sec>
         <sec>
            <st>
               <p>Genotyping of single nucleotide polymorphisms (SNPs) by allele specific oligomer hybridization (ASOH)</p>
            </st>
            <p>For the genes of this study, non-synonymous SNPs identified in Genbank's SNP database and/or non-synonynous SNPs associated with lung disease were investigated. Amplification of DNA regions encompassing the SNPs were amplified using the primers listed in Table <tblr tid="T1">1</tblr>. ASOH was performed using standard hybridization conditions <abbrgrp><abbr bid="B44">44</abbr></abbrgrp> using <sup>32</sup>P radiolabeled probes and washing temperatures described in Table <tblr tid="T1">1</tblr>. Genotyping was determined following visualization of the hybridized probe by autoradiography.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Primer List. List of primers used for DNA amplification and ASOH.</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Temp &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p47 Ex2F</p>
                     </c>
                     <c ca="left">
                        <p>GCTTCCTCCAGTGGGTAGTGGGATC</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p47 161R</p>
                     </c>
                     <c ca="left">
                        <p>GGAACTCGTAGATCTCGGTGAAGC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Temp &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 Ex2F</p>
                     </c>
                     <c ca="left">
                        <p>GTGCTGAGAGACGAATGTTGG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 Ex2R</p>
                     </c>
                     <c ca="left">
                        <p>GGGCAAGGTTCAGAGGTCAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 Ex5F</p>
                     </c>
                     <c ca="left">
                        <p>GACGGGACATCTAGGCTGG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 Ex5R</p>
                     </c>
                     <c ca="left">
                        <p>GGCTCTGGCCATGTGGAAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 Ex8F</p>
                     </c>
                     <c ca="left">
                        <p>TCTGAGGCGTGGCTCTGCTG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 Ex8R</p>
                     </c>
                     <c ca="left">
                        <p>GCTCATCTGGGAGCCACTGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 Ex10F</p>
                     </c>
                     <c ca="left">
                        <p>ATGACACGGGCTTGTATCAGG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 Ex10R</p>
                     </c>
                     <c ca="left">
                        <p>GAGCTGAAGGTTTTTGCTGGTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 86T</p>
                     </c>
                     <c ca="left">
                        <p>TGCTGACATCGAGGAGA</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 86C</p>
                     </c>
                     <c ca="left">
                        <p>TGCTGACACCGAGGAGA</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 353G</p>
                     </c>
                     <c ca="left">
                        <p>CCTGCTCAGCCTGCCGG</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 353A</p>
                     </c>
                     <c ca="left">
                        <p>CCTGCTCAACCTGCCGG</p>
                     </c>
                     <c ca="center">
                        <p>61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 815C</p>
                     </c>
                     <c ca="left">
                        <p>ACGACCACCGCCCCTCA</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 815T</p>
                     </c>
                     <c ca="left">
                        <p>ACGACCACTGCCCCTCA</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 911C</p>
                     </c>
                     <c ca="left">
                        <p>GGACGTAGCGCTCATGG</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p40 911A</p>
                     </c>
                     <c ca="left">
                        <p>GGACGTAGAGCTCATGG</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Temp &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 Ex3F</p>
                     </c>
                     <c ca="left">
                        <p>CTGGGCACCACAGGGAGCTA</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 Ex3R</p>
                     </c>
                     <c ca="left">
                        <p>CACCAAGCCCGCAACACTGA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 Ex6F</p>
                     </c>
                     <c ca="left">
                        <p>GGGCTTCTATGTGGTTATCTCAA</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 Ex6R</p>
                     </c>
                     <c ca="left">
                        <p>CCACAAGGAGGCTACCCTCTTCT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 Ex9F</p>
                     </c>
                     <c ca="left">
                        <p>GAGCCCAGGCAGGCTCAGTGTCAT</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 Ex10R</p>
                     </c>
                     <c ca="left">
                        <p>GCCATCTCAAGGCGGGCTCAAGA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 Ex11F</p>
                     </c>
                     <c ca="left">
                        <p>GTGTTTCCCCACATCCAC</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 Ex11R</p>
                     </c>
                     <c ca="left">
                        <p>AAGGCAGGGAGAGGAACT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 Ex13F</p>
                     </c>
                     <c ca="left">
                        <p>CAAGGGTTGGGCTAAAGGAC</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 Ex14R</p>
                     </c>
                     <c ca="left">
                        <p>GTGTTCTCACACCACAGAGTCAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 542G</p>
                     </c>
                     <c ca="left">
                        <p>TGTGGGCAGGCTGTTTC</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 542A</p>
                     </c>
                     <c ca="left">
                        <p>TGTGGGCAAGCTGTTTC</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 836C</p>
                     </c>
                     <c ca="left">
                        <p>CTGGGCCACGGTCATGT</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 836T</p>
                     </c>
                     <c ca="left">
                        <p>CTGGGCCATGGTCATGT</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 983G</p>
                     </c>
                     <c ca="left">
                        <p>CCCTGGAAGACCCCAGC</p>
                     </c>
                     <c ca="center">
                        <p>47</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 983A</p>
                     </c>
                     <c ca="left">
                        <p>CCCTGGAAAACCCCAGC</p>
                     </c>
                     <c ca="center">
                        <p>47</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 1105G</p>
                     </c>
                     <c ca="left">
                        <p>CTCAGCCCGGGCTCCCC</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 1105A</p>
                     </c>
                     <c ca="left">
                        <p>CTCAGCCCAGGCTCCCC</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 1167C</p>
                     </c>
                     <c ca="left">
                        <p>GCTGGAACACACTAAGCTG</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 1167A</p>
                     </c>
                     <c ca="left">
                        <p>GCTGGAACAAACTAAGCTG</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 1183C</p>
                     </c>
                     <c ca="left">
                        <p>CCAGCTATCGGCCTCGG</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p67 1183T</p>
                     </c>
                     <c ca="left">
                        <p>CCAGCTATTGGCCTCGG</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Temp &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 Ex 2F</p>
                     </c>
                     <c ca="left">
                        <p>GACCCTGTCACTGTGCTGTG</p>
                     </c>
                     <c ca="center">
                        <p>61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 Ex 2R</p>
                     </c>
                     <c ca="left">
                        <p>GAGGCAAACAGCTCACTGTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 Ex 3F</p>
                     </c>
                     <c ca="left">
                        <p>CTGAGCTGGGCTGTTCCTT</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 Ex 3R</p>
                     </c>
                     <c ca="left">
                        <p>CCACCCAACCCTGTGAGC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 Ex 4F</p>
                     </c>
                     <c ca="left">
                        <p>CAGCAAAGGAGTCCCGAGT</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 Ex 4R</p>
                     </c>
                     <c ca="left">
                        <p>GGAAAAACACTGAGGTAAGT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 Ex 5F</p>
                     </c>
                     <c ca="left">
                        <p>AAGGCTGAGAACACCCAGG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 Ex 5R</p>
                     </c>
                     <c ca="left">
                        <p>GCTCAGCCTACAGAGCCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 Ex 6F</p>
                     </c>
                     <c ca="left">
                        <p>GACCCAGGTCCTGGCTGTG</p>
                     </c>
                     <c ca="center">
                        <p>60+DMSO</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 Ex 6R</p>
                     </c>
                     <c ca="left">
                        <p>AGGCTCACGCGCTCCCGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 85A</p>
                     </c>
                     <c ca="left">
                        <p>TCGTGGCCACAGCTGGG</p>
                     </c>
                     <c ca="center">
                        <p>59</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 85G</p>
                     </c>
                     <c ca="left">
                        <p>TCGTGGCCGCAGCTGGG</p>
                     </c>
                     <c ca="center">
                        <p>59</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 113T</p>
                     </c>
                     <c ca="left">
                        <p>GTGGTACTTTGGTGCCT</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 113C</p>
                     </c>
                     <c ca="left">
                        <p>GTGGTACTCTGGTGCCT</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 179A</p>
                     </c>
                     <c ca="left">
                        <p>GAAGAGGAAGAAGGGCT</p>
                     </c>
                     <c ca="center">
                        <p>51</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 179C</p>
                     </c>
                     <c ca="left">
                        <p>GAAGAGGACGAAGGGCT</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 214C</p>
                     </c>
                     <c ca="left">
                        <p>GACAGAAGCACATGACC</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 214T</p>
                     </c>
                     <c ca="left">
                        <p>GACAGAAGTACATGACC</p>
                     </c>
                     <c ca="center">
                        <p>51</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 403G</p>
                     </c>
                     <c ca="left">
                        <p>CGCCCATCGAGCCCAAG</p>
                     </c>
                     <c ca="center">
                        <p>59</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 403A</p>
                     </c>
                     <c ca="left">
                        <p>CGCCCATCAAGCCCAAG</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 521C</p>
                     </c>
                     <c ca="left">
                        <p>GCTGCGGCGGCGGCG</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p22 521T</p>
                     </c>
                     <c ca="left">
                        <p>GCTGCGGTGGCGGCG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Temp &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox Ex 9F</p>
                     </c>
                     <c ca="left">
                        <p>CTAAAGCAGAGATCTAAGTGG</p>
                     </c>
                     <c ca="center">
                        <p>61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox Ex 9R</p>
                     </c>
                     <c ca="left">
                        <p>ACGGTGACCACAGAAATAGCTACCT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox Ex 11F</p>
                     </c>
                     <c ca="left">
                        <p>GTTTCTAGGCATTCTGAGCATCAAG</p>
                     </c>
                     <c ca="center">
                        <p>61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox Ex 11R</p>
                     </c>
                     <c ca="left">
                        <p>GTTCGTAAGCCCTGTACACTATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox Ex 12F</p>
                     </c>
                     <c ca="left">
                        <p>GTGCCTTGGTTAGAATAGCTTGTG</p>
                     </c>
                     <c ca="center">
                        <p>61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox Ex 12R</p>
                     </c>
                     <c ca="left">
                        <p>GTTGAAGATATCTGGAATCTTCTGTTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox 907C</p>
                     </c>
                     <c ca="left">
                        <p>TGGTCACTCACCCTTTC</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox 907A</p>
                     </c>
                     <c ca="left">
                        <p>TGGTCACTAACCCTTTC</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox 1414G</p>
                     </c>
                     <c ca="left">
                        <p>ACAATGCCGGCTTCCTC</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox 1414A</p>
                     </c>
                     <c ca="left">
                        <p>ACAATGCCAGCTTCCTC</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox 1499A</p>
                     </c>
                     <c ca="left">
                        <p>GGAGAAAGATGTGATC</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>gp91phox 1499G</p>
                     </c>
                     <c ca="left">
                        <p>GGAGAAAGGTGTGATC</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Temp &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX1 27F</p>
                     </c>
                     <c ca="left">
                        <p>AGAGAGATCTCCTCTCAAGG</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX1 27R</p>
                     </c>
                     <c ca="left">
                        <p>GGTCACCGGAAGAGCTGAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX1 28F</p>
                     </c>
                     <c ca="left">
                        <p>GGGACCTTGGAAGCTCCAG</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX1 28R</p>
                     </c>
                     <c ca="left">
                        <p>GGACGTCGAGAAGTGAAGAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX1 3532T</p>
                     </c>
                     <c ca="left">
                        <p>GGTCTGAGTTCCCCCAG</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX1 3532C</p>
                     </c>
                     <c ca="left">
                        <p>GGTCTGAGCTCCCCCAG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX1 3647G</p>
                     </c>
                     <c ca="left">
                        <p>GCCGCCGCCGCAGTTTCC</p>
                     </c>
                     <c ca="center">
                        <p>66</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX1 3647A</p>
                     </c>
                     <c ca="left">
                        <p>GCCGCCGCCACAGTTTCC</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Temp &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 Ex5F</p>
                     </c>
                     <c ca="left">
                        <p>ATGTTCTTTCCGACGTGGTGAG</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 Ex6R</p>
                     </c>
                     <c ca="left">
                        <p>GCGCCGCCCACATGAGCAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 Ex17F</p>
                     </c>
                     <c ca="left">
                        <p>GCCTGCTCAGACTCACAGAG</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 Ex17R</p>
                     </c>
                     <c ca="left">
                        <p>ACTCCTTAGGGATCTTGAGCAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 Ex24F</p>
                     </c>
                     <c ca="left">
                        <p>GATGCCTGCCAGATCCCCAG</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 Ex25R</p>
                     </c>
                     <c ca="left">
                        <p>TGGCCGCCGTGCCTCGTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 413T</p>
                     </c>
                     <c ca="left">
                        <p>TGGAGACCTCGTGTTCG</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 413C</p>
                     </c>
                     <c ca="left">
                        <p>TGGAGACCCCGTGTTCG</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 429A</p>
                     </c>
                     <c ca="left">
                        <p>CCGAACAGCGCGGGGAC</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 429C</p>
                     </c>
                     <c ca="left">
                        <p>CCGACCAGCGCGGGGAC</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 597-8GG</p>
                     </c>
                     <c ca="left">
                        <p>GCTTCTCGGGGGGACAG</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 597-8GA</p>
                     </c>
                     <c ca="left">
                        <p>GCTTCTCGAGGGGACAG</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 597-8CG</p>
                     </c>
                     <c ca="left">
                        <p>GCTTCTCCGGGGGACAG</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 597-8CA</p>
                     </c>
                     <c ca="left">
                        <p>GCTTCTCCAGGGGACAG</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 2048G</p>
                     </c>
                     <c ca="left">
                        <p>TGTGCTCCGTGTGGTCC</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 2048A</p>
                     </c>
                     <c ca="left">
                        <p>TGTGCTCCATGTGGTCC</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 3026G</p>
                     </c>
                     <c ca="left">
                        <p>CACTCCCCGGCTGTACA</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 3026A</p>
                     </c>
                     <c ca="left">
                        <p>CACTCCCCAGCTGTACA</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 3200T</p>
                     </c>
                     <c ca="left">
                        <p>CTTTGCCTTGCCACCCT</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DUOX2 3200C</p>
                     </c>
                     <c ca="left">
                        <p>CTTTGCCTCGCCACCCT</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Temp &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 450F</p>
                     </c>
                     <c ca="left">
                        <p>ATTGCAAATCCTGAGAGTGG</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 688R</p>
                     </c>
                     <c ca="left">
                        <p>GCAGTTCCAAACATTCCACG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 1141F</p>
                     </c>
                     <c ca="left">
                        <p>GCCTGTGAGGATGCCTGG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 1827R</p>
                     </c>
                     <c ca="left">
                        <p>GCACAGGACCCCCGTGAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 1782F</p>
                     </c>
                     <c ca="left">
                        <p>GTGCTGTGCTCTGTTCCTG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 2392R</p>
                     </c>
                     <c ca="left">
                        <p>TCCCAACTAGACAAAGACTGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 170T</p>
                     </c>
                     <c ca="left">
                        <p>GAAAAGATTTTGCTGGAC</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 170Tdel</p>
                     </c>
                     <c ca="left">
                        <p>GAAAAGATTTGCTGGAC</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 1892C</p>
                     </c>
                     <c ca="left">
                        <p>GGAAGCCCAGGAAAGCT</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 1892A</p>
                     </c>
                     <c ca="left">
                        <p>GGAAGCACAGGAAAGCT</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 2258G</p>
                     </c>
                     <c ca="left">
                        <p>CAAGCTGCGGAAGATAA</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2 2258A</p>
                     </c>
                     <c ca="left">
                        <p>CAAGCTGCAGAAGATAA</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Temp &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 Ex2F</p>
                     </c>
                     <c ca="left">
                        <p>GTGGGTGGAGGTAGAGCTG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 365R</p>
                     </c>
                     <c ca="left">
                        <p>ACAGCCAAGAAGGTGCTGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 2501F</p>
                     </c>
                     <c ca="left">
                        <p>TGCTGCATCACCTCTGTGG</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 2794R</p>
                     </c>
                     <c ca="left">
                        <p>TGCGGCTGCCATAGACCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 13C</p>
                     </c>
                     <c ca="left">
                        <p>GTTTCTGCCGCAGCGCC</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 13T</p>
                     </c>
                     <c ca="left">
                        <p>GTTTCTGCTGCAGCGCC</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 237T</p>
                     </c>
                     <c ca="left">
                        <p>CACCTCCATGATTCTGA</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 237G</p>
                     </c>
                     <c ca="left">
                        <p>CACCTCCAGGATTCTGA</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 296C</p>
                     </c>
                     <c ca="left">
                        <p>GAACTGCCCGCCGGTTG</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 296T</p>
                     </c>
                     <c ca="left">
                        <p>GAACTGCCTGCCGGTTG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 2588G</p>
                     </c>
                     <c ca="left">
                        <p>AAGTGGGCGAGATGAGG</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 2588A</p>
                     </c>
                     <c ca="left">
                        <p>AAGTGGGCAAGATGAGG</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 2644G</p>
                     </c>
                     <c ca="left">
                        <p>CGCAGAGCGCAGTGGCA</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR9 2644A</p>
                     </c>
                     <c ca="left">
                        <p>CGCAGAGCACAGTGGCA</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Temp &#176;C</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT Ex2F</p>
                     </c>
                     <c ca="left">
                        <p>TGTCGGCAAGTACTTGGCACAG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT Ex2R</p>
                     </c>
                     <c ca="left">
                        <p>CATAATGCATTGCCAAGGAGAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT Ex3F</p>
                     </c>
                     <c ca="left">
                        <p>CAGATGATGAAGCTGAGCCTCG</p>
                     </c>
                     <c ca="center">
                        <p>65</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT Ex3R</p>
                     </c>
                     <c ca="left">
                        <p>AGCCCTCTGGCCAGTCCTGATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT Ex5F</p>
                     </c>
                     <c ca="left">
                        <p>GAGCAAGGCCTATGTGACAGG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT Ex5R</p>
                     </c>
                     <c ca="left">
                        <p>AGCTCAACCCTTCTTTAATGTCAT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT 374G</p>
                     </c>
                     <c ca="left">
                        <p>ACTCCTCCGTACCCTCA</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT 374A</p>
                     </c>
                     <c ca="left">
                        <p>ACTCCTCCATACCCTCA</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT 863A</p>
                     </c>
                     <c ca="left">
                        <p>GCACCTGGAAAATGAAC</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT 863T</p>
                     </c>
                     <c ca="left">
                        <p>GCACCTGGTAAATGAAC</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT 1096G</p>
                     </c>
                     <c ca="left">
                        <p>CCATCGACGAGAAAGGG</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AAT 1096A</p>
                     </c>
                     <c ca="left">
                        <p>CCATCGACAAGAAAGGG</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Statistics</p>
            </st>
            <p>The Fisher's Exact test was performed with GraphPad InStat using the raw data entered into a 2 &#215; 2 contingency table. Power calculations were performed to give the probability of finding the differences between the gene frequencies as statistically significant, given the sample size.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>We examined 95 individuals of European, non-Hispanic origin with documented medical history with hospitalization for lung disease (46 with sarcoidosis, 43 with tuberculosis, five with recurrent pneumonia, and one with atypical mycobacterial infection) and 95 control individuals of European, non-Hispanic origin for differences in allele frequencies in genes involved in innate immunity.</p>
         <sec>
            <st>
               <p>P47phox/(NCF1)</p>
            </st>
            <p>Examination of the pseudogene: wt copy ratio of control versus lung disease individuals demonstrated no statistically significant difference in the frequencies of the pseudogene: wt ratios in the lung disease group as compared to the control group (Table <tblr tid="T2">2</tblr>).</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Pseudogene versus gene ratio. p47phox/NCF1 pseudogene: wt gene ratio in lung disease and control individuals. The data are presented as number of individuals with the indicated pseudogene:wt ratio and the number within parentheses indicates the calculated frequency.</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="center">
                        <p>
                           <b>p47phox/NCF1 (Pseudogene: wt)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>control (n = 59)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Lung Disease (n = 64)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>2:1</p>
                     </c>
                     <c ca="center">
                        <p>46 (0.78)</p>
                     </c>
                     <c ca="center">
                        <p>51 (0.80)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>1:1</p>
                     </c>
                     <c ca="center">
                        <p>13 (0.22)</p>
                     </c>
                     <c ca="center">
                        <p>12 (0.19)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>1:2</p>
                     </c>
                     <c ca="center">
                        <p>0 (0)</p>
                     </c>
                     <c ca="center">
                        <p>1 (0.02)</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>p67phox (NCF2), p40phox (NCF4), p22phox (CYBA), gp91phox (CYBB), DUOX1, DUOX2</p>
            </st>
            <p>SNPs in the <it>p67phox </it>(<it>NCF2</it>), <it>p40phox </it>(<it>NCF4</it>), <it>p22phox </it>(<it>CYBA</it>) and <it>gp91phox </it>(<it>CYBB</it>), <it>DUOX1 </it>and <it>DUOX2 </it>genes were examined. Some SNPs did not occur at a high enough frequency to be detected in our samples. None of the allele frequencies differed significantly between the lung disease and the control groups (Table <tblr tid="T3">3</tblr>).</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Summary of SNP Analyses. SNP analyses of candidate genes in lung disease versus control groups. Numbering of SNPs start from the ATG initiator methionine of the cDNA. Data are presented as number of alleles identified divided by total number of alleles examined. Numbers within parentheses are the calculated allele frequencies. Power calculations were performed using number of subjects.</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c ca="left">
                        <p>
                           <b>p67phox (NCF2)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>dbSNP rs#</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>amino acid</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Control</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Lung Disease</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 2&#215; increase</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 1.5&#215; increase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 6</p>
                     </c>
                     <c ca="left">
                        <p>rs2274064</p>
                     </c>
                     <c ca="center">
                        <p>542 A/G</p>
                     </c>
                     <c ca="center">
                        <p>K181R</p>
                     </c>
                     <c ca="center">
                        <p>79/186 (0.43)</p>
                     </c>
                     <c ca="center">
                        <p>91/190 (0.48)</p>
                     </c>
                     <c ca="center">
                        <p>0.98</p>
                     </c>
                     <c ca="center">
                        <p>0.96</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 9</p>
                     </c>
                     <c ca="left">
                        <p>rs13306581</p>
                     </c>
                     <c ca="center">
                        <p>836 C/T</p>
                     </c>
                     <c ca="center">
                        <p>T279M</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 11</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>983 G/A</p>
                     </c>
                     <c ca="center">
                        <p>R 328K</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 13</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1105 G/A</p>
                     </c>
                     <c ca="center">
                        <p>G369R</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 13</p>
                     </c>
                     <c ca="left">
                        <p>rs17849502</p>
                     </c>
                     <c ca="center">
                        <p>1167 C/A</p>
                     </c>
                     <c ca="center">
                        <p>H389Q</p>
                     </c>
                     <c ca="center">
                        <p>12/190 (0.06)</p>
                     </c>
                     <c ca="center">
                        <p>10/188 (0.05)</p>
                     </c>
                     <c ca="center">
                        <p>0.22</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 14</p>
                     </c>
                     <c ca="left">
                        <p>rs13306575</p>
                     </c>
                     <c ca="center">
                        <p>1183 C/T</p>
                     </c>
                     <c ca="center">
                        <p>R395W</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>p22phox (CYBA)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>dbSNP rs#</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>amino acid</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Control</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Lung Disease</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 2&#215; increase</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 1.5&#215; increase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>85 A/G</p>
                     </c>
                     <c ca="center">
                        <p>T29A</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>113 T/C</p>
                     </c>
                     <c ca="center">
                        <p>F38S</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>179 A/C</p>
                     </c>
                     <c ca="center">
                        <p>K60S</p>
                     </c>
                     <c ca="center">
                        <p>4/190 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0.06</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 4</p>
                     </c>
                     <c ca="left">
                        <p>rs4673</p>
                     </c>
                     <c ca="center">
                        <p>214 C/T</p>
                     </c>
                     <c ca="center">
                        <p>H72Y</p>
                     </c>
                     <c ca="center">
                        <p>61/180 (0.34)</p>
                     </c>
                     <c ca="center">
                        <p>60/190 (0.37)</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                     <c ca="center">
                        <p>0.61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>403 G/A</p>
                     </c>
                     <c ca="center">
                        <p>E135K</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 6</p>
                     </c>
                     <c ca="left">
                        <p>rs17845095</p>
                     </c>
                     <c ca="center">
                        <p>521 C/T</p>
                     </c>
                     <c ca="center">
                        <p>A174V</p>
                     </c>
                     <c ca="center">
                        <p>93/176 (0.41)</p>
                     </c>
                     <c ca="center">
                        <p>88/190 (0.46)</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                     <c ca="center">
                        <p>0.79</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>p40phox (NCF4)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>dbSNP rs#</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>amino acid</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Control</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Lung Disease</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 2&#215; increase</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 1.5&#215; increase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs13057803</p>
                     </c>
                     <c ca="center">
                        <p>86 T/C</p>
                     </c>
                     <c ca="center">
                        <p>I29T</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 5</p>
                     </c>
                     <c ca="left">
                        <p>rs9610595</p>
                     </c>
                     <c ca="center">
                        <p>353 G/A</p>
                     </c>
                     <c ca="center">
                        <p>S118N</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 8</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>815 G/A</p>
                     </c>
                     <c ca="center">
                        <p>P272L</p>
                     </c>
                     <c ca="center">
                        <p>30/190 (0.16)</p>
                     </c>
                     <c ca="center">
                        <p>29/190 (0.15)</p>
                     </c>
                     <c ca="center">
                        <p>0.68</p>
                     </c>
                     <c ca="center">
                        <p>0.22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 10</p>
                     </c>
                     <c ca="left">
                        <p>rs5995361</p>
                     </c>
                     <c ca="center">
                        <p>911 C/A</p>
                     </c>
                     <c ca="center">
                        <p>A304E</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>gp91phox (CYBB)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>dbSNP rs#</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>amino acid</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Control</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Lung Disease</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 2&#215; increase</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 1.5&#215; increase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 9</p>
                     </c>
                     <c ca="left">
                        <p>rs28935182</p>
                     </c>
                     <c ca="center">
                        <p>907 C/A</p>
                     </c>
                     <c ca="center">
                        <p>H303N</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 11</p>
                     </c>
                     <c ca="left">
                        <p>rs13306300</p>
                     </c>
                     <c ca="center">
                        <p>1414 G/A</p>
                     </c>
                     <c ca="center">
                        <p>G472S</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 12</p>
                     </c>
                     <c ca="left">
                        <p>rs28935181</p>
                     </c>
                     <c ca="center">
                        <p>1499 A/G</p>
                     </c>
                     <c ca="center">
                        <p>D500G</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Duox 1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>dbSNP rs#</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>amino acid</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Control</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Lung Disease</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 2&#215; increase</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 1.5&#215; increase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 27</p>
                     </c>
                     <c ca="left">
                        <p>rs2458236</p>
                     </c>
                     <c ca="center">
                        <p>3532 T/C</p>
                     </c>
                     <c ca="center">
                        <p>F1178L</p>
                     </c>
                     <c ca="center">
                        <p>64/184 (0.35)</p>
                     </c>
                     <c ca="center">
                        <p>56/154 (0.36)</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                     <c ca="center">
                        <p>0.63</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 28</p>
                     </c>
                     <c ca="left">
                        <p>rs2292466</p>
                     </c>
                     <c ca="center">
                        <p>3647 G/A</p>
                     </c>
                     <c ca="center">
                        <p>R1216H</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Duox 2</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>dbSNP rs#</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>amino acid</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Control</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Lung Disease</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 2&#215; increase</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 1.5&#215; increase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 5</p>
                     </c>
                     <c ca="left">
                        <p>rs2001616</p>
                     </c>
                     <c ca="center">
                        <p>413 C/T</p>
                     </c>
                     <c ca="center">
                        <p>P138L</p>
                     </c>
                     <c ca="center">
                        <p>26/188 (0.14)</p>
                     </c>
                     <c ca="center">
                        <p>22/190 (0.12)</p>
                     </c>
                     <c ca="center">
                        <p>0.59</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 5</p>
                     </c>
                     <c ca="left">
                        <p>rs7166994</p>
                     </c>
                     <c ca="center">
                        <p>429 C/A</p>
                     </c>
                     <c ca="center">
                        <p>D143E</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 6</p>
                     </c>
                     <c ca="left">
                        <p>rs2467827</p>
                     </c>
                     <c ca="center">
                        <p>598 G/A</p>
                     </c>
                     <c ca="center">
                        <p>G200R</p>
                     </c>
                     <c ca="center">
                        <p>1/188 (0.01)</p>
                     </c>
                     <c ca="center">
                        <p>1/190 (0.01)</p>
                     </c>
                     <c ca="center">
                        <p>0.05</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 17</p>
                     </c>
                     <c ca="left">
                        <p>rs8028305</p>
                     </c>
                     <c ca="center">
                        <p>2048 G/A</p>
                     </c>
                     <c ca="center">
                        <p>R683H</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 24</p>
                     </c>
                     <c ca="left">
                        <p>rs2277611</p>
                     </c>
                     <c ca="center">
                        <p>3026 G/A</p>
                     </c>
                     <c ca="center">
                        <p>A1009Q</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 25</p>
                     </c>
                     <c ca="left">
                        <p>rs269868</p>
                     </c>
                     <c ca="center">
                        <p>3200 T/C</p>
                     </c>
                     <c ca="center">
                        <p>L1067S</p>
                     </c>
                     <c ca="center">
                        <p>22/186 (0.12)</p>
                     </c>
                     <c ca="center">
                        <p>15/190 (0.08)</p>
                     </c>
                     <c ca="center">
                        <p>0.5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>TLR2</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>dbSNP rs#</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>amino acid</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Control</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Lung Disease</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 2&#215; increase</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 1.5&#215; increase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs3840097</p>
                     </c>
                     <c ca="center">
                        <p>510Tdel</p>
                     </c>
                     <c ca="center">
                        <p>F170Lfs</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743699</p>
                     </c>
                     <c ca="center">
                        <p>1232C/T</p>
                     </c>
                     <c ca="center">
                        <p>T411I</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743702</p>
                     </c>
                     <c ca="center">
                        <p>1667T/C</p>
                     </c>
                     <c ca="center">
                        <p>I556T</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743703</p>
                     </c>
                     <c ca="center">
                        <p>1736G/A</p>
                     </c>
                     <c ca="center">
                        <p>R579H</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743704</p>
                     </c>
                     <c ca="center">
                        <p>1892C/A</p>
                     </c>
                     <c ca="center">
                        <p>P631H</p>
                     </c>
                     <c ca="center">
                        <p>9/184 (0.05)</p>
                     </c>
                     <c ca="center">
                        <p>8/188 (0.04)</p>
                     </c>
                     <c ca="center">
                        <p>0.18</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2029C/T</p>
                     </c>
                     <c ca="center">
                        <p>R677W</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743706</p>
                     </c>
                     <c ca="center">
                        <p>2143T/A</p>
                     </c>
                     <c ca="center">
                        <p>Y715N</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743707</p>
                     </c>
                     <c ca="center">
                        <p>2145T/G</p>
                     </c>
                     <c ca="center">
                        <p>Y715Stop</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743708</p>
                     </c>
                     <c ca="center">
                        <p>2258G/A</p>
                     </c>
                     <c ca="center">
                        <p>R753Q</p>
                     </c>
                     <c ca="center">
                        <p>2/182 (0.01)</p>
                     </c>
                     <c ca="center">
                        <p>4/188 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>0.05</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2304G/T</p>
                     </c>
                     <c ca="center">
                        <p>E768D</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>TLR9</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>dbSNP rs#</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>amino acid</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Control</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Lung Disease</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 2&#215; increase</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 1.5&#215; increase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743842</p>
                     </c>
                     <c ca="center">
                        <p>13 C/T</p>
                     </c>
                     <c ca="center">
                        <p>R5C</p>
                     </c>
                     <c ca="center">
                        <p>2/190 (0.01)</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0.05</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743843</p>
                     </c>
                     <c ca="center">
                        <p>237T/G</p>
                     </c>
                     <c ca="center">
                        <p>H79Q</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743844</p>
                     </c>
                     <c ca="center">
                        <p>296 C/T</p>
                     </c>
                     <c ca="center">
                        <p>P99L</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743845</p>
                     </c>
                     <c ca="center">
                        <p>2588 G/A</p>
                     </c>
                     <c ca="center">
                        <p>R863Q</p>
                     </c>
                     <c ca="center">
                        <p>6/170 (0.04)</p>
                     </c>
                     <c ca="center">
                        <p>0/186 (0*)</p>
                     </c>
                     <c ca="center">
                        <p>0.14</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs5743746</p>
                     </c>
                     <c ca="center">
                        <p>2644 G/A</p>
                     </c>
                     <c ca="center">
                        <p>A882T</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>AAT (SERPINA1)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>dbSNP rs#</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SNP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>amino acid</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Control</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Lung Disease</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 2&#215; increase</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Power to detect 1.5&#215; increase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 2</p>
                     </c>
                     <c ca="left">
                        <p>rs709932</p>
                     </c>
                     <c ca="center">
                        <p>374G/A</p>
                     </c>
                     <c ca="center">
                        <p>R125H</p>
                     </c>
                     <c ca="center">
                        <p>38/178 (0.21)</p>
                     </c>
                     <c ca="center">
                        <p>29/182 (0.16)</p>
                     </c>
                     <c ca="center">
                        <p>0.85</p>
                     </c>
                     <c ca="center">
                        <p>0.31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 3</p>
                     </c>
                     <c ca="left">
                        <p>rs17580</p>
                     </c>
                     <c ca="center">
                        <p>863A/T</p>
                     </c>
                     <c ca="center">
                        <p>E288V</p>
                     </c>
                     <c ca="center">
                        <p>5/190 (0.03)</p>
                     </c>
                     <c ca="center">
                        <p>4/190 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>0.1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 4</p>
                     </c>
                     <c ca="left">
                        <p>rs28929474</p>
                     </c>
                     <c ca="center">
                        <p>1096G/A</p>
                     </c>
                     <c ca="center">
                        <p>E366K</p>
                     </c>
                     <c ca="center">
                        <p>4/192 (0.02)</p>
                     </c>
                     <c ca="center">
                        <p>2/190 (0.01)</p>
                     </c>
                     <c ca="center">
                        <p>0.07</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>TLR2, TLR9, AAT</p>
            </st>
            <p><it>TLR2</it>, <it>TLR9</it>, and <it>AAT </it>genes were examined. Again, many SNPs did not occur at high enough frequency to be observed. Most of the allele frequencies did not differ between the lung disease and control groups. The <it>TLR2 </it>polymorphism R753Q, associated with tuberculosis, was not shown to be different between the control or lung disease group. The <it>TLR2 </it>R677W polymorphism, also associated with tuberculosis, was not observed in either group. The R863Q SNP in TLR9 was absent from the lung disease group indicating that this polymorphism was not associated with increased lung disease. The <it>AAT </it>S (Glu288Val) and Z (E366K) alleles, associated with chronic obstructive lung disease, were examined and there was no difference in allele frequencies between the control and lung disease groups (Table <tblr tid="T3">3</tblr>).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Since only a subset of individuals exposed to <it>Bacillus anthracis </it>spores develop pulmonary disease, the most life-threatening form of anthrax infection, it would be important to identify factors that lead to susceptibility to this type of infection. This might make it possible to identify those individuals who are at greatest risk and to provide them with the most aggressive treatment at the outset of infection. The ability to thus triage individuals in the case of a bioterrorism attack would be valuable. Moreover, understanding genetic susceptibility could lead to better management of individuals with pulmonary anthrax infection.</p>
         <p>The genetic influences on resistance to infection are very strong. Indeed, genetic influences on resistance to infection appear to be greater than genetic influences on cancer or cardiovascular disease <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. In the past few decades a considerable number of polymorphisms have been shown to cause infectious disease susceptibility in mice <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> and in humans <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B31">31</abbr><abbr bid="B46">46</abbr></abbrgrp>. Because infections caused by <it>Bacillus anthracis </it>are rare it was impossible to examine candidate polymorphisms in patients who actually developed pulmonary anthrax. Instead, it was necessary to use surrogate infections such as unusual mycobacterial infections, recurrent pneumonia, and tuberculosis or examine lung diseases such as sarcoidosis, which has been reported in cases of inhalation anthrax, for this study. The "lung disease group" in this study represented all the individuals with documented hospitalization for lung disease from a collection of 31,247 individuals of European, non-Hispanic origin unselected for any particular acute or chronic health problem. Candidate genes were chosen on the basis of their role in immunity against chronic infection as well as their participation in the innate immune response. This is a reasonable approach, since defects in the immune system generally increases susceptibility not to a single organism, but rather to multiple organisms that share some features in the pathogenesis of the disease that they produce.</p>
         <p>Our analyses of genes of the NAD(P)H oxidase, <it>p47 </it>(<it>NCF1</it>), <it>p67phox </it>(<it>NCF2</it>), <it>p40phox </it>(<it>NCF4</it>), <it>p22phox </it>(<it>CYBA</it>), and <it>gp91phox </it>(<it>CYBB</it>), as well as other genes involved in innate immunity such as <it>DUOX1 </it>and <it>2</it>, <it>TLR2</it>, <it>TLR9 </it>and <it>AAT </it>demonstrated that there were no differences between the control and lung disease group comprised of primarily sarcoidosis and tuberculosis individuals. There may, of course, be many other polymorphisms that affect susceptibility to <it>Bacillus anthracis</it>. Although the genes that we chose seemed to be reasonable candidates; there are many additional genes encoding products that could be important in effecting the course of anthrax in humans. For example, it has been suggested that susceptibility to <it>Bacillus anthracis </it>might involve <it>myD88 </it><abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Furthermore, susceptibility to infection by tuberculosis may be altered by variations in the vitamin D receptor gene <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>. Similarly, sarcoidosis has been shown to be associated with particular alleles in <it>BTNL2 </it><abbrgrp><abbr bid="B48">48</abbr><abbr bid="B49">49</abbr></abbrgrp>, <it>IL18 </it><abbrgrp><abbr bid="B50">50</abbr></abbrgrp>, and <it>IFNa </it><abbrgrp><abbr bid="B51">51</abbr></abbrgrp>, and <it>SLC11A1 </it><abbrgrp><abbr bid="B52">52</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The author(s) declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>Each author contributed substantially to the design, acquisition, and analysis of the data. PLL supervised the project and wrote the manuscript. Each author has read and approved the manuscript prior to submission.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This is manuscript number MEM18018. This work was supported by the CDC 5PO1 CI000095 and the Stein Endowment Fund. The authors would like to thank Dr. Jill Waalen for performing the power calculations and Drs. Ernest Beutler, Gary Bokoch, Bruce Beutler, Ulla Knaus, and Bruce Zuraw for their helpful discussions.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Epidemiologic response to anthrax outbreaks: field investigations, 1950-2001</p>
            </title>
            <aug>
               <au>
                  <snm>Bales</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Dannenberg</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Brachman</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Kaufmann</snm>
                  <fnm>AF</fnm>
               </au>
               <au>
                  <snm>Klatsky</snm>
                  <fnm>PC</fnm>
               </au>
               <au>
                  <snm>Ashford</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>Emerg Infect Dis</source>
            <pubdate>2002</pubdate>
            <volume>8</volume>
            <fpage>1163</fpage>
            <lpage>1174</lpage>
            <xrefbib>
               <pubid idtype="pmpid">12396934</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Inhalation anthrax</p>
            </title>
            <aug>
               <au>
                  <snm>Brachman</snm>
                  <fnm>PS</fnm>
               </au>
            </aug>
            <source>Ann N Y Acad Sci</source>
            <pubdate>1980</pubdate>
            <volume>353</volume>
            <fpage>83</fpage>
            <lpage>93</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7013615</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Clinical presentation of inhalational anthrax following bioterrorism exposure: report of 2 surviving patients</p>
            </title>
            <aug>
               <au>
                  <snm>Mayer</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Bersoff-Matcha</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Earls</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Harper</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Pauze</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Nguyen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rosenthal</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Cerva</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Druckenbrod</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Hanfling</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Fatteh</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Napoli</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nayyar</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Berman</snm>
                  <fnm>EL</fnm>
               </au>
            </aug>
            <source>JAMA</source>
            <pubdate>2001</pubdate>
            <volume>286</volume>
            <fpage>2549</fpage>
            <lpage>2553</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11722268</pubid>
                  <pubid idtype="doi">10.1001/jama.286.20.2549</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Death due to bioterrorism-related inhalational anthrax: report of 2 patients</p>
            </title>
            <aug>
               <au>
                  <snm>Borio</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Frank</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Mani</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Chiriboga</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pollanen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ripple</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ali</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>DiAngelo</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Arden</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Titus</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Fowler</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>O'Toole</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Masur</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Bartlett</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Inglesby</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>JAMA</source>
            <pubdate>2001</pubdate>
            <volume>286</volume>
            <fpage>2554</fpage>
            <lpage>2559</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11722269</pubid>
                  <pubid idtype="doi">10.1001/jama.286.20.2554</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>The genetic basis of host resistance to Bacillus anthracis in inbred mice</p>
            </title>
            <aug>
               <au>
                  <snm>Shibaya</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kubomichi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Vet Microbiol</source>
            <pubdate>1991</pubdate>
            <volume>26</volume>
            <fpage>309</fpage>
            <lpage>312</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">2024449</pubid>
                  <pubid idtype="doi">10.1016/0378-1135(91)90024-A</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Characterization of macrophage sensitivity and resistance to anthrax lethal toxin</p>
            </title>
            <aug>
               <au>
                  <snm>Friedlander</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Bhatnagar</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Leppla</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Singh</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1993</pubdate>
            <volume>61</volume>
            <fpage>245</fpage>
            <lpage>252</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">302711</pubid>
                  <pubid idtype="pmpid">8380282</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases</p>
            </title>
            <aug>
               <au>
                  <snm>Quinn</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Gauss</snm>
                  <fnm>KA</fnm>
               </au>
            </aug>
            <source>J Leukoc Biol</source>
            <pubdate>2004</pubdate>
            <volume>76</volume>
            <fpage>760</fpage>
            <lpage>781</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15240752</pubid>
                  <pubid idtype="doi">10.1189/jlb.0404216</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>A p47-phox pseudogene carries the most common mutation causing p47-phox- deficient chronic granulomatous disease</p>
            </title>
            <aug>
               <au>
                  <snm>Gorlach</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>PL</fnm>
               </au>
               <au>
                  <snm>Roesler</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hopkins</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Christensen</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>ED</fnm>
               </au>
               <au>
                  <snm>Chanock</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Curnutte</snm>
                  <fnm>JT</fnm>
               </au>
            </aug>
            <source>J Clin Invest</source>
            <pubdate>1997</pubdate>
            <volume>100</volume>
            <fpage>1907</fpage>
            <lpage>1918</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">508379</pubid>
                  <pubid idtype="pmpid" link="fulltext">9329953</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>A complete physical contig and partial transcript map of the Williams syndrome critical region</p>
            </title>
            <aug>
               <au>
                  <snm>Hockenhull</snm>
                  <fnm>EL</fnm>
               </au>
               <au>
                  <snm>Carette</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Metcalfe</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Donnai</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Read</snm>
                  <fnm>AP</fnm>
               </au>
               <au>
                  <snm>Tassabehji</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Genomics</source>
            <pubdate>1999</pubdate>
            <volume>58</volume>
            <fpage>138</fpage>
            <lpage>145</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10366445</pubid>
                  <pubid idtype="doi">10.1006/geno.1999.5815</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Identification of a novel NCF-1 (p47-phox) pseudogene not containing the signature GT deletion: significance for A47 degrees chronic granulomatous disease carrier detection</p>
            </title>
            <aug>
               <au>
                  <snm>Heyworth</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Noack</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Cross</snm>
                  <fnm>AR</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2002</pubdate>
            <volume>100</volume>
            <fpage>1845</fpage>
            <lpage>1851</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12176908</pubid>
                  <pubid idtype="doi">10.1182/blood-2002-03-0861</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>NCF1 (p47phox) and ncf1 pseudogenes are not associated with inflammatory bowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>Suraweera</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Zampeli</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Rogers</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Atkin</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Forbes</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Harbord</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Silver</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Inflamm Bowel Dis</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <fpage>758</fpage>
            <lpage>762</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15626894</pubid>
                  <pubid idtype="doi">10.1097/00054725-200411000-00010</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Association between p47phox pseudogenes and inflammatory bowel disease</p>
            </title>
            <aug>
               <au>
                  <snm>Harbord</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hankin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bloom</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mitchison</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2003</pubdate>
            <volume>101</volume>
            <fpage>3337</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12672696</pubid>
                  <pubid idtype="doi">10.1182/blood-2002-10-3060</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Positional identification of Ncf1 as a gene that regulates arthritis severity in rats</p>
            </title>
            <aug>
               <au>
                  <snm>Olofsson</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Holmberg</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tordsson</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Akerstrom</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Holmdahl</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2003</pubdate>
            <volume>33</volume>
            <fpage>25</fpage>
            <lpage>32</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12461526</pubid>
                  <pubid idtype="doi">10.1038/ng1058</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>C242T CYBA polymorphism of the NADPH oxidase is associated with reduced respiratory burst in human neutrophils</p>
            </title>
            <aug>
               <au>
                  <snm>Wyche</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Griendling</snm>
                  <fnm>KK</fnm>
               </au>
               <au>
                  <snm>Dikalov</snm>
                  <fnm>SI</fnm>
               </au>
               <au>
                  <snm>Austin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fink</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Harrison</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Zafari</snm>
                  <fnm>AM</fnm>
               </au>
            </aug>
            <source>Hypertension</source>
            <pubdate>2004</pubdate>
            <volume>43</volume>
            <fpage>1246</fpage>
            <lpage>1251</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15078863</pubid>
                  <pubid idtype="doi">10.1161/01.HYP.0000126579.50711.62</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Functional effects of NAD(P)H oxidase p22(phox) C242T mutation in human leukocytes and association with thrombotic cerebral infarction</p>
            </title>
            <aug>
               <au>
                  <snm>Shimo-Nakanishi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hasebe</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mochizuki</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nomiyama</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Nagaoka</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Mizuno</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Urabe</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Atherosclerosis</source>
            <pubdate>2004</pubdate>
            <volume>175</volume>
            <fpage>109</fpage>
            <lpage>115</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15186954</pubid>
                  <pubid idtype="doi">10.1016/j.atherosclerosis.2004.01.043</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Angiotensin-converting enzyme and p22(phox) polymorphisms and the risk of coronary heart disease in a low-risk Spanish population</p>
            </title>
            <aug>
               <au>
                  <snm>Mata-Balaguer</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>de la</snm>
                  <fnm>HR</fnm>
               </au>
               <au>
                  <snm>Ruiz-Rejon</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ruiz-Rejon</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Garrido-Ramos</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Ruiz-Rejon</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Int J Cardiol</source>
            <pubdate>2004</pubdate>
            <volume>95</volume>
            <fpage>145</fpage>
            <lpage>151</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15193812</pubid>
                  <pubid idtype="doi">10.1016/j.ijcard.2003.05.017</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>No association between genetic polymorphisms in NAD(P)H oxidase p22phox and paraoxonase 1 and colorectal cancer risk</p>
            </title>
            <aug>
               <au>
                  <snm>Van Der Logt</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Janssen</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Van Hooijdonk</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Roelofs</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Wobbes</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nagengast</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Peters</snm>
                  <fnm>WH</fnm>
               </au>
            </aug>
            <source>Anticancer Res</source>
            <pubdate>2005</pubdate>
            <volume>25</volume>
            <fpage>1465</fpage>
            <lpage>1470</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15865106</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Dual oxidases represent novel hydrogen peroxide sources supporting mucosal surface host defense</p>
            </title>
            <aug>
               <au>
                  <snm>Geiszt</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Witta</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Baffi</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lekstrom</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Leto</snm>
                  <fnm>TL</fnm>
               </au>
            </aug>
            <source>FASEB J</source>
            <pubdate>2003</pubdate>
            <volume>17</volume>
            <fpage>1502</fpage>
            <lpage>1504</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12824283</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Regulated hydrogen peroxide production by Duox in human airway epithelial cells</p>
            </title>
            <aug>
               <au>
                  <snm>Forteza</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Salathe</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Miot</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Forteza</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Conner</snm>
                  <fnm>GE</fnm>
               </au>
            </aug>
            <source>Am J Respir Cell Mol Biol</source>
            <pubdate>2005</pubdate>
            <volume>32</volume>
            <fpage>462</fpage>
            <lpage>469</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15677770</pubid>
                  <pubid idtype="doi">10.1165/rcmb.2004-0302OC</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Dual oxidase-2 has an intrinsic Ca2+-dependent H2O2-generating activity</p>
            </title>
            <aug>
               <au>
                  <snm>Ameziane-El-Hassani</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Morand</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Boucher</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Frapart</snm>
                  <fnm>YM</fnm>
               </au>
               <au>
                  <snm>Apostolou</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Agnandji</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Gnidehou</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ohayon</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Noel-Hudson</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Francon</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lalaoui</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Virion</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dupuy</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2005</pubdate>
            <volume>280</volume>
            <fpage>30046</fpage>
            <lpage>30054</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15972824</pubid>
                  <pubid idtype="doi">10.1074/jbc.M500516200</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>NADPH oxidase-dependent acid production in airway epithelial cells</p>
            </title>
            <aug>
               <au>
                  <snm>Schwarzer</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Machen</snm>
                  <fnm>TE</fnm>
               </au>
               <au>
                  <snm>Illek</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2004</pubdate>
            <volume>279</volume>
            <fpage>36454</fpage>
            <lpage>36461</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15210697</pubid>
                  <pubid idtype="doi">10.1074/jbc.M404983200</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Identification of novel genes involved in congenital hypothyroidism using serial analysis of gene expression</p>
            </title>
            <aug>
               <au>
                  <snm>Moreno</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>Horm Res</source>
            <pubdate>2003</pubdate>
            <volume>60 Suppl 3</volume>
            <fpage>96</fpage>
            <lpage>102</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">14671405</pubid>
                  <pubid idtype="doi">10.1159/000074509</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Persistent mild hypothyroidism associated with novel sequence variants of the DUOX2 gene in two siblings</p>
            </title>
            <aug>
               <au>
                  <snm>Vigone</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Fugazzola</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Zamproni</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Passoni</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Di Candia</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Chiumello</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Persani</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Weber</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2005</pubdate>
            <volume>26</volume>
            <fpage>395</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16134168</pubid>
                  <pubid idtype="doi">10.1002/humu.9372</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Three Mutations (p.Q36H, p.G418fsX482, and g.IVS19-2A>C) in the Dual Oxidase 2 Gene Responsible for Congenital Goiter and Iodide Organification Defect</p>
            </title>
            <aug>
               <au>
                  <snm>Varela</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Rivolta</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Esperante</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Gruneiro-Papendieck</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Chiesa</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Targovnik</snm>
                  <fnm>HM</fnm>
               </au>
            </aug>
            <source>Clin Chem</source>
            <pubdate>2005</pubdate>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16322276</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>MyD88-dependent signaling contributes to protection following Bacillus anthracis spore challenge of mice: implications for Toll-like receptor signaling</p>
            </title>
            <aug>
               <au>
                  <snm>Hughes</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Lowchyj</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Grippe</snm>
                  <fnm>VK</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>MFJ</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>LY</fnm>
               </au>
               <au>
                  <snm>Harvill</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Merkel</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2005</pubdate>
            <volume>73</volume>
            <fpage>7535</fpage>
            <lpage>7540</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16239556</pubid>
                  <pubid idtype="doi">10.1128/IAI.73.11.7535-7540.2005</pubid>
                  <pubid idtype="pmcid">1273865</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Induction of direct antimicrobial activity through mammalian toll-like receptors</p>
            </title>
            <aug>
               <au>
                  <snm>Thoma-Uszynski</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Stenger</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Takeuchi</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Ochoa</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Engele</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sieling</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Barnes</snm>
                  <fnm>PF</fnm>
               </au>
               <au>
                  <snm>Rollinghoff</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bolcskei</snm>
                  <fnm>PL</fnm>
               </au>
               <au>
                  <snm>Wagner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Akira</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Norgard</snm>
                  <fnm>MV</fnm>
               </au>
               <au>
                  <snm>Belisle</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Godowski</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Bloom</snm>
                  <fnm>BR</fnm>
               </au>
               <au>
                  <snm>Modlin</snm>
                  <fnm>RL</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2001</pubdate>
            <volume>291</volume>
            <fpage>1544</fpage>
            <lpage>1547</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11222859</pubid>
                  <pubid idtype="doi">10.1126/science.291.5508.1544</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>TLR9 regulates Th1 responses and cooperates with TLR2 in mediating optimal resistance to Mycobacterium tuberculosis</p>
            </title>
            <aug>
               <au>
                  <snm>Bafica</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Scanga</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Feng</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>Leifer</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Cheever</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sher</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Exp Med</source>
            <pubdate>2005</pubdate>
            <volume>202</volume>
            <fpage>1715</fpage>
            <lpage>1724</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16365150</pubid>
                  <pubid idtype="doi">10.1084/jem.20051782</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>The Arg753GLn polymorphism of the human toll-like receptor 2 gene in tuberculosis disease</p>
            </title>
            <aug>
               <au>
                  <snm>Ogus</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Yoldas</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Ozdemir</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Uguz</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Olcen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Keser</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Coskun</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cilli</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yegin</snm>
                  <fnm>O</fnm>
               </au>
            </aug>
            <source>Eur Respir J</source>
            <pubdate>2004</pubdate>
            <volume>23</volume>
            <fpage>219</fpage>
            <lpage>223</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">14979495</pubid>
                  <pubid idtype="doi">10.1183/09031936.03.00061703</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>The importance of Toll-like receptor 2 polymorphisms in severe infections</p>
            </title>
            <aug>
               <au>
                  <snm>Texereau</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chiche</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Choukroun</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Comba</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Mira</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Clin Infect Dis</source>
            <pubdate>2005</pubdate>
            <volume>41 Suppl 7</volume>
            <fpage>S408</fpage>
            <lpage>S415</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16237639</pubid>
                  <pubid idtype="doi">10.1086/431990</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Cutting edge: a Toll-like receptor 2 polymorphism that is associated with lepromatous leprosy is unable to mediate mycobacterial signaling</p>
            </title>
            <aug>
               <au>
                  <snm>Bochud</snm>
                  <fnm>PY</fnm>
               </au>
               <au>
                  <snm>Hawn</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Aderem</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2003</pubdate>
            <volume>170</volume>
            <fpage>3451</fpage>
            <lpage>3454</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12646604</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Toll-like receptor 2 Arg677Trp polymorphism is associated with susceptibility to tuberculosis in Tunisian patients</p>
            </title>
            <aug>
               <au>
                  <snm>Ben Ali</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Barbouche</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Bousnina</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Chabbou</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dellagi</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Clin Diagn Lab Immunol</source>
            <pubdate>2004</pubdate>
            <volume>11</volume>
            <fpage>625</fpage>
            <lpage>626</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15138193</pubid>
                  <pubid idtype="doi">10.1128/CDLI.11.3.625-626.2004</pubid>
                  <pubid idtype="pmcid">404573</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Heterozygous Arg753Gln polymorphism of human TLR-2 impairs immune activation by Borrelia burgdorferi and protects from late stage Lyme disease</p>
            </title>
            <aug>
               <au>
                  <snm>Schroder</snm>
                  <fnm>NW</fnm>
               </au>
               <au>
                  <snm>Diterich</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Zinke</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Eckert</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Draing</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>von</snm>
                  <fnm>BV</fnm>
               </au>
               <au>
                  <snm>Hassler</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Priem</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hahn</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Michelsen</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Hartung</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Burmester</snm>
                  <fnm>GR</fnm>
               </au>
               <au>
                  <snm>Gobel</snm>
                  <fnm>UB</fnm>
               </au>
               <au>
                  <snm>Hermann</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Schumann</snm>
                  <fnm>RR</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2005</pubdate>
            <volume>175</volume>
            <fpage>2534</fpage>
            <lpage>2540</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16081826</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Lack of association between Toll-like receptor 2 polymorphisms and susceptibility to severe disease caused by Staphylococcus aureus</p>
            </title>
            <aug>
               <au>
                  <snm>Moore</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Segal</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Berendt</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Hill</snm>
                  <fnm>AV</fnm>
               </au>
               <au>
                  <snm>Day</snm>
                  <fnm>NP</fnm>
               </au>
            </aug>
            <source>Clin Diagn Lab Immunol</source>
            <pubdate>2004</pubdate>
            <volume>11</volume>
            <fpage>1194</fpage>
            <lpage>1197</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15539529</pubid>
                  <pubid idtype="doi">10.1128/CDLI.11.6.1194-1197.2004</pubid>
                  <pubid idtype="pmcid">524778</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Protease inhibitors in chronic obstructive pulmonary disease</p>
            </title>
            <aug>
               <au>
                  <snm>Barnett</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>Gottovi</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>AM</fnm>
               </au>
            </aug>
            <source>Am Rev Respir Dis</source>
            <pubdate>1975</pubdate>
            <volume>111</volume>
            <fpage>587</fpage>
            <lpage>593</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1079422</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>The multiple causes of alpha1-antitrypsin deficiency</p>
            </title>
            <aug>
               <au>
                  <snm>Lieberman</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Pathol Biol (Paris)</source>
            <pubdate>1975</pubdate>
            <volume>23</volume>
            <fpage>517</fpage>
            <lpage>520</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1101153</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Pulmonary emphysema and alpha 1-antitrypsin deficiency</p>
            </title>
            <aug>
               <au>
                  <snm>Tarkoff</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Kueppers</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>WF</fnm>
               </au>
            </aug>
            <source>Am J Med</source>
            <pubdate>1968</pubdate>
            <volume>45</volume>
            <fpage>220</fpage>
            <lpage>228</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">5666650</pubid>
                  <pubid idtype="doi">10.1016/0002-9343(68)90040-5</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Obstructive lung disease and alpha-1-antitrypsin deficiency gene heterozygosity</p>
            </title>
            <aug>
               <au>
                  <snm>Kueppers</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Fallat</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Larson</snm>
                  <fnm>RK</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1969</pubdate>
            <volume>165</volume>
            <fpage>899</fpage>
            <lpage>901</lpage>
            <xrefbib>
               <pubid idtype="pmpid">5816326</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Z and S mutations of the alpha1-antitrypsin gene and the risk of chronic obstructive pulmonary disease</p>
            </title>
            <aug>
               <au>
                  <snm>Sandford</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Weir</snm>
                  <fnm>TD</fnm>
               </au>
               <au>
                  <snm>Spinelli</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Pare</snm>
                  <fnm>PD</fnm>
               </au>
            </aug>
            <source>Am J Respir Cell Mol Biol</source>
            <pubdate>1999</pubdate>
            <volume>20</volume>
            <fpage>287</fpage>
            <lpage>291</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9922220</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Lung function studies in asymptomatic individuals with moderately (Pi SZ) and severely (Pi Z) reduced levels of alpha1-antitrypsin</p>
            </title>
            <aug>
               <au>
                  <snm>Larsson</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Dirksen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Sundstrom</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Eriksson</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Scand J Respir Dis</source>
            <pubdate>1976</pubdate>
            <volume>57</volume>
            <fpage>267</fpage>
            <lpage>280</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1087749</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Protease inhibitors in patients with chronic obstructive pulmonary disease: the alpha-antitrypsin heterozygote controversy</p>
            </title>
            <aug>
               <au>
                  <snm>Cox</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Hoeppner</snm>
                  <fnm>VH</fnm>
               </au>
               <au>
                  <snm>Levison</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Am Rev Respir Dis</source>
            <pubdate>1976</pubdate>
            <volume>113</volume>
            <fpage>601</fpage>
            <lpage>606</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1083700</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>The protease inhibitor PI*S allele and COPD: a meta-analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Dahl</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hersh</snm>
                  <fnm>CP</fnm>
               </au>
               <au>
                  <snm>Ly</snm>
                  <fnm>NP</fnm>
               </au>
               <au>
                  <snm>Berkey</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Silverman</snm>
                  <fnm>EK</fnm>
               </au>
               <au>
                  <snm>Nordestgaard</snm>
                  <fnm>BG</fnm>
               </au>
            </aug>
            <source>Eur Respir J</source>
            <pubdate>2005</pubdate>
            <volume>26</volume>
            <fpage>67</fpage>
            <lpage>76</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15994391</pubid>
                  <pubid idtype="doi">10.1183/09031936.05.00135704</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Alpha1-antitrypsin deficiency allele carriers among lung cancer patients</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Wentzlaff</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Katzmann</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Marks</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Allen</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Lesnick</snm>
                  <fnm>TG</fnm>
               </au>
               <au>
                  <snm>Lindor</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Myers</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Wiegert</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Midthun</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Thibodeau</snm>
                  <fnm>SN</fnm>
               </au>
               <au>
                  <snm>Krowka</snm>
                  <fnm>MJ</fnm>
               </au>
            </aug>
            <source>Cancer Epidemiol Biomarkers Prev</source>
            <pubdate>1999</pubdate>
            <volume>8</volume>
            <fpage>461</fpage>
            <lpage>465</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10350443</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>The effect of HFE genotypes in patients attending a health appraisal clinic</p>
            </title>
            <aug>
               <au>
                  <snm>Beutler</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Felitti</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Gelbart</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ho</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Ann Intern Med</source>
            <pubdate>2000</pubdate>
            <volume>133</volume>
            <fpage>329</fpage>
            <lpage>337</lpage>
            <url>http://c:\b#\pdf\b1166.pdf</url>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10979877</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>A study of genes that may modulate the expression of hereditary hemochromatosis: Transferrin receptor-1, ferroportin, ceruloplasmin, ferritin light and heavy chains, iron regulatory proteins (IRP)-1 and -2, and hepcidin</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>PL</fnm>
               </au>
               <au>
                  <snm>Gelbart</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>West</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Halloran</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Felitti</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Beutler</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Blood Cells Mol Dis</source>
            <pubdate>2001</pubdate>
            <volume>27</volume>
            <fpage>783</fpage>
            <lpage>802</lpage>
            <url>http://c:\b#\pdf\b1217.pdf</url>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11783942</pubid>
                  <pubid idtype="doi">10.1006/bcmd.2001.0445</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Genetic and environmental influences on premature death in adult adoptees</p>
            </title>
            <aug>
               <au>
                  <snm>Sorensen</snm>
                  <fnm>TI</fnm>
               </au>
               <au>
                  <snm>Nielsen</snm>
                  <fnm>GG</fnm>
               </au>
               <au>
                  <snm>Andersen</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>Teasdale</snm>
                  <fnm>TW</fnm>
               </au>
            </aug>
            <source>N Engl J Med</source>
            <pubdate>1988</pubdate>
            <volume>318</volume>
            <fpage>727</fpage>
            <lpage>732</lpage>
            <xrefbib>
               <pubid idtype="pmpid">3347221</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>The role of red blood cell polymorphisms in resistance and susceptibility to malaria</p>
            </title>
            <aug>
               <au>
                  <snm>Lell</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>May</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Schmidt-Ott</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Lehman</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Luckner</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Greve</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Matousek</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Schmid</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Herbich</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Mockenhaupt</snm>
                  <fnm>FP</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>Bienzle</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Kremsner</snm>
                  <fnm>PG</fnm>
               </au>
            </aug>
            <source>Clinical Infectious Diseases</source>
            <pubdate>1999</pubdate>
            <volume>28</volume>
            <fpage>794</fpage>
            <lpage>799</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10825041</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Meta-analysis of vitamin D receptor polymorphisms and pulmonary tuberculosis risk</p>
            </title>
            <aug>
               <au>
                  <snm>Lewis</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Davey</snm>
                  <fnm>SG</fnm>
               </au>
            </aug>
            <source>Int J Tuberc Lung Dis</source>
            <pubdate>2005</pubdate>
            <volume>9</volume>
            <fpage>1174</fpage>
            <lpage>1177</lpage>
            <xrefbib>
               <pubid idtype="pmpid">16229232</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>The BTNL2 gene and sarcoidosis susceptibility in African Americans and Whites</p>
            </title>
            <aug>
               <au>
                  <snm>Rybicki</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Walewski</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Maliarik</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Kian</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Iannuzzi</snm>
                  <fnm>MC</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2005</pubdate>
            <volume>77</volume>
            <fpage>491</fpage>
            <lpage>499</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16080124</pubid>
                  <pubid idtype="doi">10.1086/444435</pubid>
                  <pubid idtype="pmcid">1226214</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Sarcoidosis is associated with a truncating splice site mutation in BTNL2</p>
            </title>
            <aug>
               <au>
                  <snm>Valentonyte</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Hampe</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Huse</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Rosenstiel</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Albrecht</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Stenzel</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nagy</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gaede</snm>
                  <fnm>KI</fnm>
               </au>
               <au>
                  <snm>Franke</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Haesler</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Koch</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lengauer</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Seegert</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Reiling</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Ehlers</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Schwinger</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Platzer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Krawczak</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Muller-Quernheim</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Schurmann</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Schreiber</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>2005</pubdate>
            <volume>37</volume>
            <fpage>357</fpage>
            <lpage>364</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15735647</pubid>
                  <pubid idtype="doi">10.1038/ng1519</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Association of single nucleotide polymorphisms in the IL-18 gene with sarcoidosis in a Japanese population</p>
            </title>
            <aug>
               <au>
                  <snm>Takada</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Morohashi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Gejyo</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Tissue Antigens</source>
            <pubdate>2002</pubdate>
            <volume>60</volume>
            <fpage>36</fpage>
            <lpage>42</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12366781</pubid>
                  <pubid idtype="doi">10.1034/j.1399-0039.2002.600105.x</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Association between IFNA genotype and the risk of sarcoidosis</p>
            </title>
            <aug>
               <au>
                  <snm>Akahoshi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ishihara</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Remus</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Uno</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Miyake</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hirota</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nakashima</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Matsuda</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kanda</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Enomoto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ohno</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nakashima</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Casanova</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Hopkin</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Tamari</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mao</snm>
                  <fnm>XQ</fnm>
               </au>
               <au>
                  <snm>Shirakawa</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Hum Genet</source>
            <pubdate>2004</pubdate>
            <volume>114</volume>
            <fpage>503</fpage>
            <lpage>509</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15004750</pubid>
                  <pubid idtype="doi">10.1007/s00439-004-1099-5</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Association between SLC11A1 (formerly NRAMP1) and the risk of sarcoidosis in Poland</p>
            </title>
            <aug>
               <au>
                  <snm>Dubaniewicz</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Jamieson</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Dubaniewicz-Wybieralska</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fakiola</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nancy</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Blackwell</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Eur J Hum Genet</source>
            <pubdate>2005</pubdate>
            <volume>13</volume>
            <fpage>829</fpage>
            <lpage>834</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15702130</pubid>
                  <pubid idtype="doi">10.1038/sj.ejhg.5201370</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

